Table1: Primers used in miR-9 and SMC1A RT-PCR test.

Gene Primer Sequence
GAPDH GAPDHF AAGGTCGGAGTCAACGGATT
GAPDHR CTCCTGGAAGATGGTGATGG
SMC1A SMC1A-QF TCGGA CCATT TCAGA GGTTCA
SMC1A-QR TCCTC AGAGT AGACC ATGCT G
miR-9 Mi9RT (for reverse transcription) CTCAACTGGTGTCGTGGAGTCGG
CAATTCAGTTGAG tca tacag
mi9F ACACTCCAGCTGGG tcttt ggtta tctag
mi9R TGGTGTCGTGGAGTCG
U6 U6F CTCGCTTCGGCAGCACA
U6R AACGCTTCACGAATTTGCGT

Back to Article