The bacterial expression vector, pET23d, was purchased from Novagen (Madison, WI, USA). Oligonucleotides used forsite-directed mutagenesis and DNA sequencing were purchased fromOperon Technologies (San Pablo, CA). Restriction endonucleases used for screening mutants were purchased fromNew England Biolabs (Beverly, MA). Activated CH-Sepharose 4B and 3’-aminothymidine used to make the thymidine affinity column were purchased from Sigma (St. Louis, MO). Tritiated thymidine ([methyl-³H] thymidine, specific activity 90 Ci/mmol) was purchased from Amersham (Arlington Heights, IL) and [8-H]-ganciclovir (specific activities, 14.7 and 19.1 Ci/mmol) was purchased from Moravek Biochemicals (Brea, CA). All other reagents were purchased from Sigma (St. Louis, MO) unless otherwise denoted.

The oligonucleotide used to construct the A168F mutant is: 5’ GCAAGGAGGAAGGCGATGGGGTGGCG 3’. Oligonucleotides used to construct the A168Y mutant are: 5’ CTTCGACCGCCACCCCATCGCCTACCTCCTGTGC 3’ and 5’ GGAGGTAGGCGATGGGGTGGCGG 3’. The single-stranded DNA template for site-directed mutagenesis was isolated from pET23d:HSVTK (CJ236) [15]as described in Black and Hruby [18]. The single-stranded DNA was then used as a template for Kunkel-based site-directed mutagenesis[19,20] for the A168F mutant. The A168Y mutant was created using a Stratagene QuikChange kit (La Jolla, CA) according to the manufacturer’s directions, with dsDNA of pET23d:HSVTK as the backbone. Transformants were screened by restriction enzyme digestion for the loss of a BstF51 site. Sequence analysis was performed on purified mutant plasmid DNA to confirm the mutation at the A168 position.

To evaluate the level of activity to thymidine (dT) and GCV, mutant and wild-type HSV TK plasmids were transformed into a thymidine kinase-deficient E. coli (BL21 (DE3) tdk^-) and used to inoculate 3 mL of TK selection broth [21]. After an overnight incubation, cultures were serially diluted in 0.9% NaCl and spread onto 2 x YT containing carbenicillin (50 μg/mL)or TK selection plates containing different concentrations of prodrug as described in Black and Loeb [21]. Colony growth was scored after 16-24 hours at 37(C.

Expression and lysate preparation of wild-type and mutant HSV thymidine kinases were performed as described by Black et al. [15]. Enzymes were purified by affinity chromatography to near homogeneity using a 3’-aminothymidine sepharose column as described in Kokoris and Black [22]. Enzyme concentrations were determined using a Pierce BCA Protein Assay Kit (Rockford, IL) according to the manufacturer’s protocol, using BSA as the protein standard.

Thymidine kinase activity assays were performed using varying substrate and enzyme concentrations. The assay used to detect the phosphorylation of the nucleosides [methyl-³H]-thymidine and [8-³H], except all washes were done at room temperature and the assays were performed at 37°C. The assays were conducted in triplicate three or more times. Data were plotted as the double reciprocal of velocity versus substrate concentration for each substrate. The Michaelis-Menten constant (K_m) was determined using the double-reciprocal plots for each substrate. A conversion factor was determined for each [³H]-nucleoside monophosphate by measuring the cpms for a known number of moles of each tritiated nucleoside. The k_cat values were calculated using this conversion factor from the double reciprocal plots assuming one active site per monomer.

One µg of each DNA (pUB (vector alone), pUB:TK, pUB:TK A168F, pUB:TK A168Y, pUB:TK mutant 30, pUB:TK SR39) was used to transfect 1 x 10⁵ rat C6 glioma cells by lipofection using FuGENE 6 transfection reagent (Roche Diagnostics, Penzberg, Germany) at a 3:1 ratio according to the manufacturer’s directions. Immunoblots were performed to assess protein levels. Briefly, pools of transfectants were harvested and resuspended at 100,000 cells/μL in lysis buffer (for 2 mL: 2 μL 1 M DTT, 20 μL 1 M HEPES, 40 μL Nonidet P40 (Roche Diagnostics, Pernzberg, Germany) 2 μL MgAc₂, H₂O to final volume). The resuspended pellets were incubated on ice for 20 min and subjected to centrifugation at 4(C for 20 min to pellet debris. Samples (10 μL per well) were run on a 15% SDS gel, transferred to a nitrocellulose membrane and blocked with 3% gelatin in Tris-buffered saline. The membrane was probed with rabbit polyclonal TK antibody followed by goat anti-rabbit AP-conjugated antibody. The blot was developed using the AP Conjugate Substrate Kit (Bio-Rad, Hercules, CA). To determine the cytotoxicity of GCV pools of transfectants were transferred to 96-well microtiter plates at an initial density of 500 cells per well in DMEM plus supplements [17]. After cell adherence overnight, GCV (0-125 μM) was added in sets of eight wells for each concentration tested. The plates were incubated for 6 days at 37ºC in 5% CO₂ at which time the redox-indicator dye Alamar Blue was added. Cell survival was determined several hours later as according to the manufacturer’s instructions and the data were plotted with a standard error of the mean bar. At least three replicates were performed.

Coordinates for the HSV TK structures with thymidine and GCV bound were obtained from the Protein Data Bank files 1KIM, 1KI2, and 2KI5 respectively [24,25]. Structures were refined using the Crystallography and NMR System (CNS) software version 1.1 [26]. Each of these structures was used to generate a model with either a phenylalanine or a tyrosine in position 168. All models (mutant and wild-type) were first subjected to 200 steps of gradient minimization, and then 1000 steps of torsion angle dynamics with slow-cooled annealing were performed from 1250 to 298 K with 25 K temperature drops per cycle. Molecular modeling and model analysis was performed using the computer graphics program XtalView [27]. Raster3D was used to generate figures [28].

To explore the role of the A168 substitutions seen in the HSV TK mutants, mutant 30[15] and SR39 [16] (Fig. 1), site-directed mutagenesis of wild-type HSV TK was used to create two mutant HSV TK enzymes, A168F and A168Y. The A168 residue was substituted by a phenylalanine, as seen in SR39, or a tyrosine, as seen in mutant 30. An initial evaluation of the thymidine and prodrug activity of these mutants was performed in a thymidine kinase-deficient E. coli, BL21 (DE3) tdk^-, as outlined in Materials and Methods (data not shown). Both A168 mutants were able to complement the TK-deficient E. coli under selective conditions. When GCV is used in a secondary selection, A168Y displays similar sensitivity as compared to wild-type HSV TK expressing cells. A168F, however, revealed an increased sensitivity to GCV as monitored by a reduced colony size relative to wild-type expressing cells.

Further biochemical characterization of the mutant and wild-type enzymes was done using dT and GCV as substrates. First, enzymes were purified by affinity chromatography to near homogeneity using a 3’-aminothymidine sepharose column [22]. Next, purified wild-type and mutant HSV TK enzymes were characterized using a filter binding assay previously described by Hruby and Ball [23]. The optimal substrate concentrations and enzyme amounts were determined for each substrate. All three enzymes (wild-type, A168F and A168Y) display non-linear Michaelis-Menten kinetics. The kinetic parameters were determined using double-reciprocal plots for each substrate.

As shown in Table 1, the A168Y mutant displays a similar K_m value, or affinity, for dT compared to wild-type (K_m = 1.06µM) with a value of 1.18 μM. However, the k_cat, or turnover number, for this mutant is about 2% of the wild-type value with dT. Therefore, the overall efficiency (k_cat/K_m = 0.70 s^-1/μM) of this mutant is less than 2% wild-type (k_cat/K_m = 38.02 s^-1/μM). The A168Y mutant has a K_m value for GCV of 45.8 μM – equivalent to the wild-type K_m of 45.5 μM. Once again, this mutant displays a lower k_catthan wild-type, causing the efficiency value to be less than 11% that of wild-type. However, an important point to note is that endogenous thymidine within the cell competes with GCV for the active site. Therefore, the relative specificity constant for the prodrug and dT should be taken into consideration. For A168Y the relative specificity constant [(k_cat/K_{m (prodrug)})/[(k_cat/K_{m (prodrug)}) + (k_cat/K_{m (dT)})]] is over 5.3-fold higher than that for the wild-type enzyme with GCV as the substrate.

Overall, the A168Y mutation in HSV TK causes a dramatic reduction in k_cat values for both dT and GCV whereas the K_m values remain unchanged. In comparison to kinetic values previously obtained for mutant 30 [17], the A168Y single mutation does not lead to as great an increase in activity towards GCV (Fig. 2). Mutant 30 has a 67-fold increase in relative specificity for GCV, while the A168Y mutant has only a 5.3-fold increase in relative specificity for GCV.

Fig. (2). Mutant enzyme relative specificity differences compared to wild-type enzyme for ganciclovir. Using the equation, (kcat/Km (GCV))/((kcat/Km (GCV)) + (kcat/Km (dT))), the relative specificities were calculated. This equation takes into account the presence of endogenous thymidine that could compete with prodrug for the active site. The data are plotted as the fold increase from wild-type enzyme. Mutant 30 and SR39 values have been taken from Kokoris et al. [17] and [22], respectively.

Both K_m (1.7µM) and k_cat (51.0 s^-1) values for A168F with respect to thymidine are slightly higher than those of the wild-type enzyme (K_m = 1.06µM; k_cat = 40.3 s^-1) (Table 1). With GCV as the substrate, the A168F mutant has a K_m 5.3-fold lower than that of wild-type HSV TK and a k_cat of 91.1 s^-1; 1.65-fold higher than that of the wild-type enzyme. Thus the catalytic efficiency (k_cat/K_m) of A168F for GCV is nearly 9-fold higher when compared to wild-type values. Although this mutant displays close to 9-fold greater preference for GCV than wild-type HSV TK based upon the relative specificity observed, A168F has a relative specificity constant 90% less than that of SR39 for GCV [22] (Fig. 2).

To determine the prodrug activity of these mutants in vitro, mammalian expression vectors encoding the TK variants were constructed and used to transfect rat C6 glioma cells (see Materials and Methods). Immunoblot analyses of lysates from the pools of transfectants show similar expression levels for all of the mutants and wild-type TK, with no detectable expression in vector control pools (data not shown). Pools of stable transfectants were assayed for their level of GCV sensitivity over a drug range of 1-500 μM. Representative results of the prodrug sensitivities displayed by the TK mutants, wild-type TK and a vector control are shown in Fig. 3. Little to no toxicity was observed with vector alone at the lower prodrug doses. Surprisingly, no increased sensitivity was observed with either A168F or A168Y in comparison to wild-type TK for GCV (Fig. 3). Both mutant 30 and SR39 display about 100-fold increases in IC₅₀ from wild-type TK (IC₅₀ = 30 μM) and is similar what has been previously reported [15,16].

Fig. (3). Sensitivity of TK-expressing rat C6 constructs to GCV. Pools of stable transfectants containing vector only (pUB), wild-type TK, A168F, A168Y, Mutant 30 and SR39 were constructed and transfected in rat C6 glioma cells and evaluated for prodrug sensitivity as described in Materials and Methods. After six days of prodrug treatment, the growth inhibition was determined by staining with Alamar Blue and fluorescence recorded at 530/590 nm. Each data point (mean ± SEM, n=3 performed with at least fifteen replicates) is expressed as a percentage of the value for control wells with no prodrug treatment.

Despite the replacement of a small hydrophobic side chain at position 168 with either an aromatic phenylalanine residue or bulky and polar tyrosine, many of the original contacts between protein and ligand are conserved after molecular dynamics/simulated annealing. In fact, these dramatic mutations are mainly accommodated by rearrangements in side-chain positions while the backbone undergoes relatively minor adjustments (Fig. 4). These rearrangements allow the maintenance of hydrophobic and ionic interactions between the protein and both the nucleoside base analog and the sugar constituents of all ligands. Most notably, the hydrophobic tyrosine at position 172 (Y172) and methionine 128 (M128) residues sandwich the ring and define its placement within the binding site.

Fig. (4). Superposition of HSV TK active site residues (residue numbers 58, 128-132,168-172, 222-225 (unlabeled in figure)). All three panels have consistent coloring: wild-type: yellow; A168F: blue; and A168Y: green. Models of wild-type and mutant proteins in complex with: A. Thymidine (thy); B. GCV.

This conservation of the binding site is achieved largely because the substituted residues point directly away from the ligand and fit nicely into a hydrophobic pocket that is present in the wild-type structure, composed of residues leucine 169 (L169), F190, and L193. The filling of the binding pocket results in a slight rearrangement, presenting a highly complementary surface to GCV.

It should be noted that the final orientation of the mutated residue is somewhat dependent on its placement in the initial modeling. After molecular dynamics, one of two orientations is acquired; the residue either points toward the ligand (into contact with charged residues and disturbing the binding pocket) or away from it (as described above). These two structures converged to a similar total energy and might represent two structures that are present in vivo. However, because the binding pocket is greatly perturbed when the mutant residue points towards the ligand, a finding that is inconsistent with the kinetic data presented, we think it is highly unlikely the mutation results in this conformation.