Histidine 117 in the His-Gly-Ser-Asp motif is Required for the Biochemical Activities of Nucleoside Diphosphate Kinase of Mycobacterium smegmatis

Table 1: Oligonucleotide Primers Used

Name of the Oligo Primer	Sequence of the Oligo Primer	For Cloning

Msndk-f2	cggggtaccgtgactgagcggaccctcgtacttatcaagcc	MsNDK ORF cloning
Msndk-r2	ccggaattcggcggtggcctcgccggg	MsNDK ORF cloning
MsNDK-H117Qf	cacgcaggacaatctcgtgcagggttccgattc	MsNDK-H117Q cloning
MsNDK-H117Qr	ctcgggcgaatcggaaccgtccacgagattg	MsNDK-H117Q cloning

Note: Restriction enzyme sites are underlined. The mutation introduced is given in bold nucleotide letters.