Table 1: Primer used in this study to express the Gp07, rNTD, rCTD and ΔGp07.

Name Sequence(5′-3′)# Purpose
C-gp07-F AAACCATGGGAATGTGGGTGTTGAGGAAAAAGGAGG Forward primer for synthesis of Gp07 and rNTD
C-gp07-R AAACTCGAGCGCTCCCCCTAAATTAGCTTCATAAC Reverse primer for Synthesis of Gp07 and ΔGp07
#Used primer, restriction sites are underlined; for PCR, Tm is calculated for the bases in bold.