The Open Microbiology Journal




ISSN: 1874-2858 ― Volume 14, 2020
RESEARCH ARTICLE

A Nanoparticles based Microbiological Study on the Effect of Rosemary and Ginger Essential Oils against Klebsiella pneumoniae.



Rania Abozahra*, 1, Sarah M. Abdelhamid1, Ming Ming Wen2, Ibrahim Abdelwahab3, Kholoud Baraka1
1 Department of Microbiology and Immunology, Faculty of Pharmacy, Damanhour University, Damanhour, Egypt
2 Department of Pharmaceutics & Pharmaceutical Technology, Faculty of Pharmacy and Drug manufacturing, Pharos University in Alexandria, Alexandria, Egypt
3 Department of Microbiology and Immunology, Faculty of Pharmacy & Drug Manufacturing, Pharos University in Alexandria, Alexandria, Egypt

Abstract

Background:

Klebsiella pneumoniae is a nosocomial pathogen in outbreaks of hospital infections. It is one of the major factors for morbidity and mortality in hospitalized patients especially those infected with colistin-resistant pathogens. Many plant essential oils have antimicrobial activities and have been investigated as natural sources to combat multiple antibiotic resistances. Moreover, recent advances in phytonanotechnology have created exciting opportunities for the management of many infections.

Objective:

This study aims at investigating the antimicrobial and antibiofilm effect of rosemary and ginger essential oil-based nano-sized formulations on colistin resistant K. pneumonia clinical isolates.

Methods:

Isolation and identification of 30 K. pneumonia isolates from different human samples were done followed by antibiotic susceptibility testing and detection of biofilm gene (mrkD). Examination of the activity of the tested essential oils and their chitosan nanoparticle formulations against the selected isolates was made by determination of their MICs using broth microdilution method followed by biofilm inhibition test and quantitative real-time PCR for the expression of mrkD gene in the presence of the oils and nanoparticles formulations compared to untreated bacterial isolates.

Results:

Our results showed that the minimum inhibitory concentration of rosemary and ginger oils was 1250 μg/ml, that of nanostructured lipid carrier-rosemary oil and nanostructured lipid carrier-ginger oil was 625 μg/ml and rosemary oil loaded chitosan nanoparticles and ginger oil loaded chitosan nanoparticles possessed minimum inhibitory concentration of 156 μg/ml. Results also revealed complete (100%) inhibition for mrkD gene expression when compared to untreated K. pneumonia.

Conclusion:

Oil loaded chitosan nanoparticles showed the highest antimicrobial and antibiofilm activity.

Keywords: Klebsiella pneumoniae, Nanostructured lipid carrier nanoparticles, Essential oil-loaded chitosan nanoparticles, antibiofilm activity , Antibiotic resistances, Lipid carrier-ginger oil.


Article Information


Identifiers and Pagination:

Year: 2020
Volume: 14
First Page: 205
Last Page: 212
Publisher Id: TOMICROJ-14-205
DOI: 10.2174/1874285802014010205

Article History:

Received Date: 10/6/2020
Revision Received Date: 26/7/2020
Acceptance Date: 30/7/2020
Electronic publication date: 05/09/2020
Collection year: 2020

© 2020 Abozahra et al.

open-access license: This is an open access article distributed under the terms of the Creative Commons Attribution 4.0 International Public License (CC-BY 4.0), a copy of which is available at: https://creativecommons.org/licenses/by/4.0/legalcode. This license permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.


* Address correspondence to this author at Department of Microbiology and Immunology, Faculty of Pharmacy, Damanhour University, Damanhour, Egypt; Tel: 002 01284458834; Fax: 002 0453334596; E-mails: Rania_abozahra@yahoo.com; Rania.ragab@pharm.dmu.edu.eg





1. INTRODUCTION

Infections caused by Gram negative bacteria are of particular concern; these organisms are highly efficient in the regulation or acquisition of genes encoding antibiotic resistance mechanisms, particularly in the presence of antibiotic selection pressure [1Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative bacteria. N Engl J Med 2010; 362(19): 1804-13.
[http://dx.doi.org/10.1056/NEJMra0904124] [PMID: 20463340]
]. In addition, they use multiple mechanisms against the same antibiotic or a single mechanism to affect multiple antibiotics [2Blair JMA, Webber MA, Baylay AJ, Ogbolu DO, Piddock LJV. Molecular mechanisms of antibiotic resistance. Nat Rev Microbiol 2015; 13(1): 42-51.
[http://dx.doi.org/10.1038/nrmicro3380] [PMID: 25435309]
].

Klebsiella pneumonia is one of the most common opportunistic pathogens from either nosocomial and community- acquired infections. It causes a wide array of infectious diseases including pneumonia, septicemia, and urinary tract infections UTI [3Gautam RK, Nagar V, Shashidhar R. Effect of radiation processing in elimination of Klebsiella pneumoniae from food. Radiat Phys Chem 2015; 115: 107-11.
[http://dx.doi.org/10.1016/j.radphyschem.2015.06.016]
]. In fact, K. pneumonia is second to Escherichia coli as an etiologic agent of community-acquired UTI [4Zhou T, Zhang Y, Li M, Yu X, Sun Y, Xu J. An outbreak of infections caused by extensively drug-resistant Klebsiella pneumoniae strains during a short period of time in a Chinese teaching hospital: epidemiology study and molecular characteristics. Diagn Microbiol Infect Dis 2015; 82(3): 240-4.
[http://dx.doi.org/10.1016/j.diagmicrobio.2015.03.017] [PMID: 25865067]
, 5Borges CR, Lascowski KM, Filho NR, Pelayo JS. Microbiological quality of water and dialysate in a haemodialysis unit in Ponta Grossa-PR, Brazil. J Appl Microbiol 2007; 103(5): 1791-7.
[http://dx.doi.org/10.1111/j.1365-2672.2007.03431.x] [PMID: 17953589]
]. Unfortunately, the ability of K. pneumonia to acquire multiple drug resistance, particularly extended-spectrum β-lactamases (ESBLs), can worsen the condition [6Upadhyay S, Hussain A, Mishra S, Maurya AP, Bhattacharjee A, Joshi SR. Genetic environment of plasmid mediated ctx-m-15 extended Spectrum beta-lactamases from clinical and food borne bacteria in North-eastern India. PLoS One 2015; 10(9)e0138056
[http://dx.doi.org/10.1371/journal.pone.0138056] [PMID: 26361395]
].

In Egypt, K. pneumonia infections rates have gone up dramatically. Molecular typing and virulence analysis are powerful tools that can shed light on K. pneumonia infections, with an increasing prevalence of multidrug-resistant (MDR) patterns [7Wasfi R, Elkhatib WF, Ashour HM. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals. Nat Publ Gr 2016; 1-11.
[http://dx.doi.org/10.1038/srep38929]
].

Virulence factors comprise mechanisms allowing pathogenic bacteria to cause infections like siderophores, capsular polysaccharides, aggregative adhesion, and both types 1 and 3 fimbriae play an important role in infection severity [8Vuotto C, Longo F, Balice MP, Donelli G, Varaldo PE. Antibiotic Resistance Related to Biofilm Formation in Klebsiella pneumoniae. Pathogens 2014; 3(3): 743-58.
[http://dx.doi.org/10.3390/pathogens3030743] [PMID: 25438022]
]. In type 3 fimbriate bacteria, bacterial binding that leads to colonization and biofilm formation on plastic devices such as endotracheal tubes may be more effective. Type 3 fimbriae of K. pneumoniae is chromosomally encoded by the mrkABCDF operon [9Madsen JS, Riber L, Kot W, et al. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer. PLoS One 2016; 11(9)e0162390
[http://dx.doi.org/10.1371/journal.pone.0162390] [PMID: 27627107]
], and it consists of the major fimbrial subunit mrkA and the adhesion mrkD that have previously been shown to mediate collagen binding. The MrkA polypeptide contains the major structural component of type 3 fimbriae and is polymerized to form the fimbrial shaft. The MrkA polypeptide might facilitate adsorption to abiotic polymers of recently implanted devices. The MrkD protein functions as the type 3 fimbrial adhesin and mediates binding to extracellular matrix (ECM) proteins such as collagen molecules. The formation of biofilms by K. pneumonia on plastic surfaces is independent of the presence of the MrkD adhesin, but is facilitated by the presence of the fimbrial shaft on the surface of the bacteria [10Jagnow J, Clegg S, Clegg S. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix- and collagen-coated surfaces. Microbiology 2003; 149(Pt 9): 2397-405.
[http://dx.doi.org/10.1099/mic.0.26434-0] [PMID: 12949165]
].

The use of Essential Oils to fight Multidrug Resistance is a generous source of a number of compounds with potential application for the treatment of several infectious diseases. Many investigated essential oils, derived from local botanical plants are promising candidates that might be used against MDR bacteria. Yet there is still a vast flora that could provide additional antimicrobial leads and drugs once systemically explored [11Kingston DGI. Modern natural products drug discovery and its relevance to biodiversity conservation. J Nat Prod 2011; 74(3): 496-511.
[http://dx.doi.org/10.1021/np100550t] [PMID: 21138324]
].

Recent advances in phytonanotechnology have provided exciting opportunities for the management of many diseases, including infections. Nanoparticles are colloidal systems with a compact structure in which the therapeutic agent is coated on the particle surface by adsorption or conjugation. These nanocarriers can interact with and penetrate into bacteria, providing unique bactericidal mechanisms. Many nanoparticles can provide sustained, controlled drug release because of their compact nature. Furthermore, the biodistribution profile of nanocarriers can be controlled by modifying their surface physicochemical properties to target the tissue of interest. Therefore, nanotechnology is promising for more efficient drug delivery to target cells, improving the therapeutic management of infectious diseases [12Khan T, Gurav P. PhytoNanotechnology: Enhancing Delivery of Plant Based Anti-cancer Drugs. Front Pharmacol 2018; 8: 1002.
[http://dx.doi.org/10.3389/fphar.2017.01002] [PMID: 29479316]
].

There are very few studies focusing on the investigation of antimicrobial activities of medicinal plants nanotechnology against clinically isolated antibiotic-resistant pathogens. Hence the aim of this work is to investigate the antimicrobial effect of Rosemary and Ginger nanostructured lipid carriers and chitosan nanoparticles dosage form on clinically isolated strains of colistin-resistant K. pneumonia.

2. MATERIALS AND METHODS

2.1. Bacterial Strains

Thirty K. pneumonia isolates were obtained from sputum specimens from patients in Alexandria Fever Hospital. For the identification of isolates, VITEK 2 automated system (Bio-Merieux, l’Etoile, France) was used.

2.2. Antimicrobial Susceptibility

Antimicrobial susceptibility testing was performed using the disc diffusion method; antibiotic discs tested were Ampicillin (AMP, 10μg), Ampicillin/sulbactam (SAM, 10/10μg), Cefazolin (KZ, 30μg), Cefepime (FEP, 30μg), Ceftriaxone (CRO, 30μg), Cefuroxime (CXM, 30μg), Imipenem (IPM, 10μg), Gentamicin (CN, 10μg), Tetracycline (TE, 30μg), Levofloxacin (LEV, 5μg), Trimetho- prime/Sulphamethoxazole (TMP/SMX, 1.25/23.75 μg), Chloramphenicol (C, 30μg), Amikacin (AMK, 30μg) (Oxoid, UK) and colistin (CL, 10 μg) (Himedia) on all isolates. Obtained values were interpreted according to the Clinical and Laboratory Standards Institute (CLSI (2019) into sensitive, intermediate and resistant categories.

2.3. Biofilm Formation Assay

The biofilm-forming ability of all K. pneumonia isolates was tested using the microtiter plate method [13Stepanovic S, Vukovic D, Dakic I, Savic B, Svabic-Vlahovic M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J Microbiol Methods 2000; 40(2): 175-9.
[http://dx.doi.org/10.1016/S0167-7012(00)00122-6] [PMID: 10699673]
]. Overnight, nutrient broth cultures were diluted to 1:100 in fresh nutrient broth; then 200 μL of the freshly inoculated medium was dispensed into wells of a 96-well polystyrene microtiter plate. Negative control wells contained broth only. After 24 h of incubation at 37ºC, the content of each well was aspirated, and each well was washed with 250 μL of sterile physiological saline. Then plates were stained for 5 min with 0.2 ml of 2% crystal violet. Excess stain was rinsed off under running tap water. After the plates were air-dried, the dye bound to the adherent cells was eluted with 160 µl of 95% (v/v) ethanol. The Optical Density (OD) was measured at 630 nm by using an automated reader. Assays were performed in triplicate and the average was taken. The cut-off OD (ODC) was defined as three standard deviations above the mean OD of the negative control; the isolates were classified as follows: O.D ≤ O.Dc, non adherent; O.Dc<O.D ≤ 2 ×O.Dc weakly adherent; 2 ×O.Dc<O.D ≤ 4 ×O.Dc moderately adherent and 4 ×O.Dc<O.D strongly adherent.

2.4. PCR for Detection of the Adhesion mrkD Gene

The oligonucleotide primers synthesized by Thermo Fisher Scientific company (USA) 5'- CCACCAACTATT- CCCTCGAA -3' and 5'- ATGGAACCCACATCGACATT -3' were used to amplify mrkD gene [14Sahly H, Navon-Venezia S, Roesler L, et al. Extended-spectrum β-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella pneumoniae. Antimicrob Agents Chemother 2008; 52(9): 3029-34.
[http://dx.doi.org/10.1128/AAC.00010-08] [PMID: 18573929]
]. Genomic DNA from K. pneumonia isolates was extracted by boiling [15Amagliani G, Magnani M. Detection of Listeria monocytogenes using a commercial PCR kit and different DNA extraction methods. Microbiology 2007; 18: 1137-42.]. A 25 μl reaction volume was used for all PCRs with mixtures that contained 12.5 μl of PCR Master Mix reagents (One PCR Ultra Supermix w Fluorescent Dye, GeneDireX - MB208-0100, USA), 50 pmol of the forward and reverse primers and 5 μL of the DNA template. The PCR cycling parameters were: Initial denaturation for 3 minutes at 94°C, denaturation for 40 seconds at 94°C, annealing for 1 min at 55C, extension for 2 min at 72°C, and final extension for 5 min at 72°C. DNA fragments were detected on 1% agarose gel (GeneDireX - MB755-0100, USA) with ethidium bromide staining.

2.5. Essential oils (EOs) Isolation and Gas Chromatograph/Mass Spectroscopy (GC-MS) Analysis

Ginger and Rosemary were ground into a fine powder and then 200 gm of each was used to prepare the oil by Cleavenger hydrodistillation method [16Flamini G, Tebano M, Cioni PL, Ceccarini L, Ricci AS, Longo I. Comparison between the conventional method of extraction of essential oil of Laurus nobilis L. and a novel method which uses microwaves applied in situ, without resorting to an oven. J Chromatogr A 2007; 1143(1-2): 36-40.
[http://dx.doi.org/10.1016/j.chroma.2007.01.031] [PMID: 17239898]
]. The distilled oil in the graduated tube of 1 ml and 6 ml respectively, was collected and dried over anhydrous sodium sulphate and preserved in a dark glass bottle and then kept in the refrigerator (4-8°C) till use. The prepared oils were analyzed using GC/MS (Thermo Fisher Scientific, Germany). The relative amount of individual components of the total oil is expressed as a percentage peak area relative to the total peak area. Qualitative identification of the different constituents was performed by comparison of their relative retention times and mass spectra with those of Retention Indices (RI) and mass spectra.

2.6. Preparation of Nanostructured Lipid Carrier-EO Nanoparticles

2.6.1. Preparation of Nanoparticles

We prepared two types of nanoparticles for this study. Nanostructured lipid carrier nanoparticles (NLCs) were prepared using stearic acid, Labrafacand Tween 80. Rosemary or ginger oil was incorporated into the lipid phase. Both lipid and aqueous surfactant phases were heated separately to 60oC. The melted lipid phase was then added to the aqueous solution dropwise under high shear homogenizer following sonification [17Safwat S, Ishak RAH, Hathout RM, Mortada ND. Nanostructured lipid carriers loaded with simvastatin: Effect of PEG/glycerides on characterization, stability, cellular uptake efficiency and in vitro cytotoxicity Drug Dev Ind Pharm 2017; 0(0): 000.
[http://dx.doi.org/10.1080/03639045.2017.1293681]
].

Essential oil-loaded chitosan nanoparticles (Np-CS) were prepared with two concentrations, 1% (w/v) and 0.5% (w/v). Medium molecular weight chitosan solution was first mixed with surfactant and rosemary/ginger oil. The mixture was then cross-linked with tripolyphosphate and stirred until opalescent colloid appeared [18Woranuch S, Yoksan R. Eugenol-loaded chitosan nanoparticles: I. Thermal stability improvement of eugenol through encapsulation. Carbohydr Polym 2013; 96(2): 578-85.
[http://dx.doi.org/10.1016/j.carbpol.2012.08.117] [PMID: 23768603]
].

2.6.2. Particle Size, Zeta Potential, Polydispersity Index and Entrapment Efficiency of Nanoparticles

Particle size, zeta potential and PDI of both prepared NLCs and chitosan nanoparticles were measured by Dynamic Light Scattering (DLS) using Zetasizer Nano ZS. Samples were diluted several times with deionized water before measuring to avoid multiple scattering.

The entrapment efficiency of rosemary or ginger oils in nanoparticles was determined indirectly by the difference between the total amount of rosemary/ginger oils used in the formulation and the amount of unentrapped oils. The amount of unentrapped oils was determined using a Spin-Pure eppendorf filter tube by centrifugation. The filtrate concentration was determined by UV/VIS spectrophotometer. All the measurements were performed in triplicates [17Safwat S, Ishak RAH, Hathout RM, Mortada ND. Nanostructured lipid carriers loaded with simvastatin: Effect of PEG/glycerides on characterization, stability, cellular uptake efficiency and in vitro cytotoxicity Drug Dev Ind Pharm 2017; 0(0): 000.
[http://dx.doi.org/10.1080/03639045.2017.1293681]
].

2.6.3. Transmission Electron Microscope (TEM)

The morphology of representing CS-Rosemary nanoparticles was examined by transmission electron microscopy (JEOL, Japan). The average size was calculated using the IMAGEJ software [17Safwat S, Ishak RAH, Hathout RM, Mortada ND. Nanostructured lipid carriers loaded with simvastatin: Effect of PEG/glycerides on characterization, stability, cellular uptake efficiency and in vitro cytotoxicity Drug Dev Ind Pharm 2017; 0(0): 000.
[http://dx.doi.org/10.1080/03639045.2017.1293681]
].

2.7. Determination of Minimal Inhibitory Concentration (MIC)

The rosemary oil, ginger oil, NSLC-rosemary, NSLC-ginger, Np-CS-rosemary and Np-CS-ginger (2.5 mg/ml) were 2 fold serially diluted in sterile nutrient broth and then 200 µl of formulations were distributed in each well of a 96-well polystyrene microtitre plate. Each well received 10 µl of diluted overnight broth cultures of the tested microorganisms to reach a final inoculum of about 0.5 mcfarland in the reaction wells. The plate was incubated at 37°C for 24 hrs and then visually examined for microbial growth to determine the MIC values. Uninoculated wells containing the oils and their nanoformulations were included in the experiment as negative controls (CLSI (2019)).

2.8. Biofilm Inhibition Assay

The effect of ¾, ½ and ¼ MIC of rosemary oil, ginger oil and their chitosan formulations on biofilm formation was detected by using the microtitre plate method. Different concentrations of antimicrobial agents prepared in 100 μl of TSB were added to microtiter wells containing 100 μl of the inoculum prepared as described above. Quantitation of biofilms was performed after 24 h of incubation at 37°C, as described for the biofilm formation assay. Drug-free medium was used in control wells [19Mag P, Derakhshan S, Sattari M, Bigdeli M. Effect of cumin (Cuminum cyminum) seed essential oil on bio fi lm formation and plasmid Integrity of Klebsiella pneumoniae. Pharmacogn Mag 2010; 57-62.].

2.9. RNA Isolation and Quantitative Real-time RT-PCR

For transcriptional analysis, K. pneumonia was inoculated into 25 ml of nutrient broth in 250 ml shake flasks at a starting OD 600 of 0.05, and then cultured at 37 °C for 5 h with 250 rpm agitation in the presence or absence of ½ MIC of rosemary oil, ginger oil and their chitosan formulation. Extracted RNAs were evaluated by Nanodrop instrument (Thomas Scientific, US). Total RNA was isolated using a RNA-spin™ Total RNA Extraction Kit (iNtRON - 17211, South Korea). The transcription levels of type 3 adhesin fimbriae gene (mrkD) were determined by qRT-PCR, with or without rosemary oil, ginger oil and their chitosan formulation; rpoB [20Naparstek L, Carmeli Y, Navon-Venezia S, et al. Biofilm formation and susceptibility to gentamicin and colistin of extremely drug-resistant KPC-producing Klebsiella pneumoniae. J Antimicrob Chemother 2014; 69(4): 1027-34.
[http://dx.doi.org/10.1093/jac/dkt487] [PMID: 24408988]
] was used as housekeeping gene 1 and rrsA [21Landman D, Bratu S, Quale J. Contribution of OmpK36 to carbapenem susceptibility in KPC-producing Klebsiella pneumoniae. J Med Microbiol 2009; 58(Pt 10): 1303-8.
[http://dx.doi.org/10.1099/jmm.0.012575-0] [PMID: 19556371]
] as housekeeping gene 2 as control and qRT-PCR data were normalized by rpoB and rrsA transcriptions. qRT-PCR was performed using a TOPreal™ One-step RT qPCR Kit (SYBR Green with low ROX) (enzynomics - RT432S, South Korea) and an ABI StepOne Real-Time PCR System (Applied Biosystems) [22Kim Y, Lee J, Kim S, Baek K, Lee J. International journal of food microbiology cinnamon bark oil and its components inhibit bio fi lm formation and toxin production. Int J Food Microbiol 2015; 195: 30-9.
[http://dx.doi.org/10.1016/j.ijfoodmicro.2014.11.028] [PMID: 25500277]
].

3. RESULTS

3.1. Antimicrobial Susceptibility

The antibiotic susceptibility profile for all strains is shown in Table 1. All K. pneumonia isolates were β-lactam resistant with varied resistance degrees for the rest of the tested antibiotics where aminoglycosides and colistin showed the lowest resistance patterns.

3.2. Biofilm Formation

The results showed that 100% (30) of the tested K. pneumonia isolates were strong biofilm formers. The 13 colistin resistant, strong biofilm forming K. pneumonia isolates were selected to continue the study.

3.3. Detection of the Adhesion mrkD Gene by PCR

Upon amplifying mrkD gene using the conventional PCR technique, all the 13 selected isolates gave positive results as shown in Fig. (1), where a 240 bp amplification product was visualized in gel electrophoresis analysis.

3.4. Particle Size, Polydispersity Index, Zeta Potential, and Entrapment Efficiency of Nanoparticles

Table 2 presents the Particle Size (PS), Zeta Potential (ZP), Polydispersion Distribution Index (PDI) and Entrapment Efficiency (EE%) of the nano-formulations. NLCs had much larger particle sizes than nanoparticles prepared by chitosan. When increasing the concentration of chitosan from 0.5% to 1%, the nanoparticle sizes also increased. Chitosan is an unbranched cationic biopolymer, therefore, all prepared chitosan nanoparticles carried positive charges. In contrast, nanostructured lipid carriers were negatively charged. However, zeta potential indicated more stable formulation in NLC because the particles expel each other due to stronger negative charges. NLCs had more monodispersion of nanoparticles than CS which had larger pdi indicating more heterogenic dispersed particles. When chitosan concentration increased, the mixture became more heterogeneous as both particle size and PDI significantly increased.

Both NLC and CS formulations showed high entrapment efficiency (> 90%) with the highest value of 99.25% in 0.5% CS-Ginger. In general, CS had higher EE% than NLC.

Table 1
Resistance profile of the tested K. pneumoniae isolates to different antimicrobial agents.


Fig. (1)
Agarose gel showing PCR amplicons of mrkD gene with a size of 240 bp. Lanes 1,2,3,4,5,6,8,9,10,11,12,13 and 14 are loaded with samples and lane 7 loaded with 100 bp DNA ladder. All lanes are positive.


Table 2
Particle size (PS), zeta potential (ZP), polydispersion distribution index (PDI) and entrapment efficiency (EE%) of the nano-formulations.


Table 3
Biofilm inhibition by the tested oils and their chitosan formulations on strong biofilm forming K. pneumoniae.


3.5. Transmission Electron Microscope (TEM)

Fig. (2) shows the TEM image of 0.5% CS-Rosemary nanoparticles indicating spherical shapes with an average size of around 55 nm. These nanoparticles were well distributed and few agglomerations were observed.

Fig. (2)
Representative TEM image of 0.5% CS-Rosemary nanoparticles.


3.6. Determination of MICs

For the selected thirteen isolates, the MIC of rosemary oil and ginger oil was found to be 1250 μg/ml, the MIC of NSLC-Rosemary oil and NSLC-Ginger oil was 625 μg/ml and the MIC value of rosemary oil Np-CS loaded chitosan nanoparticles - and ginger oil Np-CS loaded chitosan nanoparticles was 156 μg/ml. There was a statistically significant difference between the MIC rosemary oil and ginger oil with their NSLC and Np-CS chitosan formulation. (Z = -3.606; p<0.001) Using Wilcoxon Signed Ranks test and also Mann-Whitney test indicated that the MIC was lesser for chitosan formulation (median=156) than for NSLC (median=625), (U=84.5; p<0.01), so chitosan nanoparticles were chosen to test biofilm inhibition assay and RT PCR.

3.7. Biofilm inhibition

Table 3 shows the inhibitory effect of the oils and their chitosan-nanoparticle formulations used on the selected 13 isolates.

3.8. Quantitative Real-time RT-PCR for mrkD, the Adhesin of Type 3 Fimbriae of K. pneumonia

The ability of ½ MIC of the oils and their chitosan nanoparticle formulation to inhibit the expression of adhesion gene mrkD in K. pneumonia treated with oils and their chitosan formulation was assessed using qPCR and using two housekeeping genes rpoB and rrsA as a reference standard. Our results revealed a 100% complete inhibition for mrkD gene expression when compared to untreated K. pneumonia.

4. DISCUSSION

Klebsiella pneumonia is an opportunistic pathogen and a frequent cause of infections. The increased resistance of this pathogen is leading to limited therapeutic options. In the present study, all our tested isolates were resistant to all β-lactam antibiotics; these results were in accordance with the results of Caneiras et al., where 93.5% and 87.1% of their isolates were resistant to ceftazidime and cefotaxime respectively [23Caneiras C, Lito L, Melo-Cristino J, Duarte A. Community- and Hospital-Acquired Klebsiella pneumoniae urinary tract infections in portugal: virulence and antibiotic resistance. Microorganisms 2019; 7(5): 138.
[http://dx.doi.org/10.3390/microorganisms7050138] [PMID: 31100810]
]. Similarly, Montso et al. found that 66.7-100% of their isolates were resistant to β-lactams [24Montso KP, Dlamini SB, Kumar A, Ateba CN. Antimicrobial Resistance Factors of Extended-Spectrum Beta-Lactamases Producing Escherichia coli and Klebsiella pneumoniae Isolated from Cattle Farms and Raw Beef in North-West Province, South Africa. BioMed Res Int 2019; 20194318306
[http://dx.doi.org/10.1155/2019/4318306] [PMID: 31915693]
]. Moreover, our tested isolates showed 100% resistance to imipenim; in contrast, other studies showed that imipenim was one of the most effective antibiotics [25Aires-de-Sousa M, Ortiz de la Rosa JM, Gonçalves ML, Pereira AL, Nordmann P, Poirel L. Epidemiology of Carbapenemase-Producing Klebsiella pneumoniae in a Hospital, Portugal. Emerg Infect Dis 2019; 25(9): 1632-8.
[http://dx.doi.org/10.3201/eid2509.190656] [PMID: 31441424]
].

We found that 80% of our isolates were chloramphenicol resistant; also Wu et al. reported that 68.75% of their tested K. pneumonia were chloramphenicol resistant [26Wu F, Ying Y, Yin M, et al. Molecular characterization of a multidrug-resistant klebsiella pneumoniae strain R46 isolated from a rabbit. International journal of genomics 2019; 2019
[http://dx.doi.org/10.1155/2019/5459190]
]. In contrast to our results, Caneiras et al. found that 83.9% of their isolates were resistant to gentamycin [23Caneiras C, Lito L, Melo-Cristino J, Duarte A. Community- and Hospital-Acquired Klebsiella pneumoniae urinary tract infections in portugal: virulence and antibiotic resistance. Microorganisms 2019; 7(5): 138.
[http://dx.doi.org/10.3390/microorganisms7050138] [PMID: 31100810]
], while in our study, aminoglycosides showed better efficacy where the resistance ranged from 36-43%.

Colistin is effective against many Gram-negative bacteria and is considered as one of the last-resort antibiotics for the treatment of human infections caused by multidrug-resistant Gram-negative bacteria. In this study, we reported high colistin resistance (43%) which was also reported by Falagas et al. [27Falagas ME, Bliziotis IA, Kasiakou SK, Samonis G, Athanassopoulou P, Michalopoulos A. Outcome of infections due to pandrug-resistant (PDR) Gram-negative bacteria. BMC Infect Dis 2005; 5(1): 24.
[http://dx.doi.org/10.1186/1471-2334-5-24] [PMID: 15819983]
].

Klebsiella pneumonia can form a thick layer of biofilm as one of its important virulence factors, allowing the bacteria to attach to biotic or abiotic surfaces that contribute to drug resistance. Resistance of biofilm-mediated infections to effective chemotherapy has many adverse effects on patient outcomes and survival [28Seifi K, Kazemian H, Heidari H, et al. Evaluation of Biofilm Formation Among Klebsiella pneumoniae Isolates and Molecular Characterization by ERIC-PCR. Jundishapur J Microbiol 2016; 9(1)e30682
[http://dx.doi.org/10.5812/jjm.30682] [PMID: 27099694]
]. All our tested isolates (100%) were strong biofilm-forming; this percentage is much higher than the results found by Seif et al. [29Liu Q, Meng X, Li Y, Zhao CN, Tang GY, Li H. Bin. Antibacterial and antifungal activities of spices. Int J Mol Sci 2017; 18(6): 1-62.
[http://dx.doi.org/10.3390/ijms18061283]
] where only 33%, 52.1%, 8.5% and 6.4% of their isolates were strong, moderate, weak and non-biofilm formers.

Rosemary EO expressed important antibacterial activities on many bacterial species [28Seifi K, Kazemian H, Heidari H, et al. Evaluation of Biofilm Formation Among Klebsiella pneumoniae Isolates and Molecular Characterization by ERIC-PCR. Jundishapur J Microbiol 2016; 9(1)e30682
[http://dx.doi.org/10.5812/jjm.30682] [PMID: 27099694]
]. Ginger EO is widely used as an ingredient in food, pharmaceutical, cosmetics, other industries and antimicrobial activities. These oils are identified as monoterpenes in the literature and are indicated to affect the cell membrane as a toxic agent deforming the structure and function of the microbial cell membrane [30Avcioglu NH, Sahal G, Bilkay IS. ANTIBIOFILM EFFECTS of Citrus limonum and Zingiber officinale Oils on BIOFILM FORMATION of Klebsiella ornithinolytica, Klebsiella oxytoca and Klebsiella terrigena SPECIES. Afr J Tradit Complement Altern Med 2016; 13(6): 61-7.
[http://dx.doi.org/10.21010/ajtcam.v13i6.10] [PMID: 28480361]
]. Many studies have reported an enhancement of the antimicrobial and physical properties of EOs-loaded nanoemulsions as compared to their conventional emulsions [31Jamil B, Abbasi R, Abbasi S, et al. Encapsulation of Cardamom Essential Oil in Chitosan Nano-composites: In-vitro Efficacy on Antibiotic-Resistant Bacterial Pathogens and Cytotoxicity Studies. Front Microbiol 2016; 7(October): 1580.
[http://dx.doi.org/10.3389/fmicb.2016.01580] [PMID: 27757108]
].

In this study, the MIC of rosemary and ginger oils against 13 isolates was found to be 1250 μg/ml, whereas the MIC of these oils formulated on Nanostructured lipid carrier nanoparticles was 625 μg/ml, and the lowest MIC was found with the use of Essential oil-loaded chitosan nanoparticles formulation which was 156 μg/ml. This shows that there was an 8-fold increase in the antibacterial effect of these essential oils against K. pneumonia isolates which can be attributed to the synergetic effect of the chitosan and essential oil when being combined in NPs. Tavassoli et al. indicated that rosemary EO showed higher inhibitory effects on bacteria (MICs: 0.5-1.5 mg/mL) tested than on yeasts [32Tavassoli SK, Mousavi SM, Razavi SH. Chemical composition and evaluation of antimicrobial properties of Rosmarinus officinalis L. essential oil. Afr J Biotechnol 2011; 10(63): 13895-9.
[http://dx.doi.org/10.5897/AJB11.788]
]. Several studies have demonstrated that nanoparticles (NPs) functionalized with essential oils have a significant antimicrobial effect against MDR pathogens due to increased solubility and chemical stability, decreased rapid evaporation and minimized degradation of active essential oil components [31Jamil B, Abbasi R, Abbasi S, et al. Encapsulation of Cardamom Essential Oil in Chitosan Nano-composites: In-vitro Efficacy on Antibiotic-Resistant Bacterial Pathogens and Cytotoxicity Studies. Front Microbiol 2016; 7(October): 1580.
[http://dx.doi.org/10.3389/fmicb.2016.01580] [PMID: 27757108]
]. Many essential oils have excellent antimicrobial activity against pathogenic microorganisms. However, their utilization is very limited due to low water solubility and less stability due to environmental factors including heat, moisture, and oxygen. Nano-sized formulations have emerged as a viable solution in order to improve water dispersion and protect EOs from degradation [32Tavassoli SK, Mousavi SM, Razavi SH. Chemical composition and evaluation of antimicrobial properties of Rosmarinus officinalis L. essential oil. Afr J Biotechnol 2011; 10(63): 13895-9.
[http://dx.doi.org/10.5897/AJB11.788]
, 33Lammari N, Louaer O, Meniai AH, Elaissari A. Encapsulation of Essential Oils via Nanoprecipitation Process: Overview, Progress, Challenges and Prospects. Pharmaceutics 2020; 12(5): 431.
[http://dx.doi.org/10.3390/pharmaceutics12050431] [PMID: 32392726]
]. They may also prevent evaporation of volatile components and offer controlled and targeted release [33Lammari N, Louaer O, Meniai AH, Elaissari A. Encapsulation of Essential Oils via Nanoprecipitation Process: Overview, Progress, Challenges and Prospects. Pharmaceutics 2020; 12(5): 431.
[http://dx.doi.org/10.3390/pharmaceutics12050431] [PMID: 32392726]
].

Because the formation of biofilms was one of the most important problems affecting the treatment of infectious diseases particularly in MDR strains, new essential oils with high bacteriostatic or bactericidal activity grouped at phytoalexins were being used in the treatment of different infectious diseases. Being produced to protect against microbial infections, it was not surprising to see their inhibition effects on microbial growth or antibiofilm effects on different microorganisms, hence leading to new treatment strategies. Various researches have been investigated with different essential oils and it has been observed that these oils have antibiofilm effects on various bacterial and fungal species [34Chouhan S, Sharma K, Guleria S. Antimicrobial Activity of Some Essential Oils-Present Status and Future Perspectives. Medicines (Basel) 2017; 4(3): 1-21.
[PMID: 28930272]
].

Different Sub MIC concentrations ranging from ¾ to ¼ MIC were used to inhibit biofilm formation. Table 3 shows biofilm inhibition of the oil alone and its Chitosan formulation where a drastic decrease in biofilm formation was noticed with Chitosan formulation.

In vitro, fimbriae from a variety of bacterial species were shown to facilitate biofilm formation. The type 3 fimbriae of K. pneumonia are comprised of the major fimbrial subunit (MrkA) and the adhesin (MrkD) that has been shown to mediate binding to collagen. The presence of the MrkD adhesin was necessary for growth on collagen-coated surfaces, unlike biofilm formation on abiotic plastic surfaces. Fimbriate strains lacking the MrkD adhesin did not efficiently grow on and adhere to these surfaces. The MrkD adhesin could enable bacterial adhesion and growth on polymers coated with host-derived proteins. Our results showed a 100% total inhibition of mrkD gene expression upon treatment of K. pneumonia with ½ MIC of the oils and their chitosan nanoparticle formulation relative to untreated cultures in qPCR because the addition of carboxymethyl groups enhances the overall positive charge on chitosan molecules, leading to greater contact with negatively charged components as lipopolysaccharides and proteins present in the bacterial membrane, leading to degradation of the membrane and the release of large intracellular material outside of the cells [35Ma Z, Garrido-Maestu A, Jeong KC. Application, mode of action, and in vivo activity of chitosan and its micro- and nanoparticles as antimicrobial agents: A review. Carbohydr Polym 2017; 176: 257-65.
[http://dx.doi.org/10.1016/j.carbpol.2017.08.082] [PMID: 28927606]
, 36Bai H, You Y, Yan H, et al. Antisense inhibition of gene expression and growth in gram-negative bacteria by cell-penetrating peptide conjugates of peptide nucleic acids targeted to rpoD gene. Biomaterials 2012; 33(2): 659-67.
[http://dx.doi.org/10.1016/j.biomaterials.2011.09.075] [PMID: 22000398]
].

CONCLUSION

In conclusion, oil loaded chitosan nanoparticles show the highest antimicrobial and antibiofilm activity which can be used as antibiotic alternatives to promote health and reduce the emergence of antibioticresistance.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The study was approved by the Faculty of Pharmacy, Damanhour University, Egypt, with Ref.no. (318PM3).

HUMAN AND ANIMAL RIGHTS

No human or animals were used in the study.

CONSENT FOR PUBLICATION

All patients participated on a voluntary basis and gave their informed consent.

AVAILABILITY OF DATA AND MATERIALS

The data that support the findings of this study are available from the corresponding author [R.A], upon reasonable request.

FUNDING

None.

CONFLICT OF INTEREST

The authors whose names are listed certify that they have no affiliations with or involvement in any organization or entity with any financial interest, or non-financial interest in the subject matter or materials discussed in this manuscript.

ACKNOWLEDGEMENTS

I would like to thank the Faculty of Pharmacy, Pharos University, and the Faculty of Pharmacy. Damanhour University, for providing material and moral support.

REFERENCES

[1] Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative bacteria. N Engl J Med 2010; 362(19): 1804-13.
[http://dx.doi.org/10.1056/NEJMra0904124] [PMID: 20463340]
[2] Blair JMA, Webber MA, Baylay AJ, Ogbolu DO, Piddock LJV. Molecular mechanisms of antibiotic resistance. Nat Rev Microbiol 2015; 13(1): 42-51.
[http://dx.doi.org/10.1038/nrmicro3380] [PMID: 25435309]
[3] Gautam RK, Nagar V, Shashidhar R. Effect of radiation processing in elimination of Klebsiella pneumoniae from food. Radiat Phys Chem 2015; 115: 107-11.
[http://dx.doi.org/10.1016/j.radphyschem.2015.06.016]
[4] Zhou T, Zhang Y, Li M, Yu X, Sun Y, Xu J. An outbreak of infections caused by extensively drug-resistant Klebsiella pneumoniae strains during a short period of time in a Chinese teaching hospital: epidemiology study and molecular characteristics. Diagn Microbiol Infect Dis 2015; 82(3): 240-4.
[http://dx.doi.org/10.1016/j.diagmicrobio.2015.03.017] [PMID: 25865067]
[5] Borges CR, Lascowski KM, Filho NR, Pelayo JS. Microbiological quality of water and dialysate in a haemodialysis unit in Ponta Grossa-PR, Brazil. J Appl Microbiol 2007; 103(5): 1791-7.
[http://dx.doi.org/10.1111/j.1365-2672.2007.03431.x] [PMID: 17953589]
[6] Upadhyay S, Hussain A, Mishra S, Maurya AP, Bhattacharjee A, Joshi SR. Genetic environment of plasmid mediated ctx-m-15 extended Spectrum beta-lactamases from clinical and food borne bacteria in North-eastern India. PLoS One 2015; 10(9)e0138056
[http://dx.doi.org/10.1371/journal.pone.0138056] [PMID: 26361395]
[7] Wasfi R, Elkhatib WF, Ashour HM. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals. Nat Publ Gr 2016; 1-11.
[http://dx.doi.org/10.1038/srep38929]
[8] Vuotto C, Longo F, Balice MP, Donelli G, Varaldo PE. Antibiotic Resistance Related to Biofilm Formation in Klebsiella pneumoniae. Pathogens 2014; 3(3): 743-58.
[http://dx.doi.org/10.3390/pathogens3030743] [PMID: 25438022]
[9] Madsen JS, Riber L, Kot W, et al. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer. PLoS One 2016; 11(9)e0162390
[http://dx.doi.org/10.1371/journal.pone.0162390] [PMID: 27627107]
[10] Jagnow J, Clegg S, Clegg S. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix- and collagen-coated surfaces. Microbiology 2003; 149(Pt 9): 2397-405.
[http://dx.doi.org/10.1099/mic.0.26434-0] [PMID: 12949165]
[11] Kingston DGI. Modern natural products drug discovery and its relevance to biodiversity conservation. J Nat Prod 2011; 74(3): 496-511.
[http://dx.doi.org/10.1021/np100550t] [PMID: 21138324]
[12] Khan T, Gurav P. PhytoNanotechnology: Enhancing Delivery of Plant Based Anti-cancer Drugs. Front Pharmacol 2018; 8: 1002.
[http://dx.doi.org/10.3389/fphar.2017.01002] [PMID: 29479316]
[13] Stepanovic S, Vukovic D, Dakic I, Savic B, Svabic-Vlahovic M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J Microbiol Methods 2000; 40(2): 175-9.
[http://dx.doi.org/10.1016/S0167-7012(00)00122-6] [PMID: 10699673]
[14] Sahly H, Navon-Venezia S, Roesler L, et al. Extended-spectrum β-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella pneumoniae. Antimicrob Agents Chemother 2008; 52(9): 3029-34.
[http://dx.doi.org/10.1128/AAC.00010-08] [PMID: 18573929]
[15] Amagliani G, Magnani M. Detection of Listeria monocytogenes using a commercial PCR kit and different DNA extraction methods. Microbiology 2007; 18: 1137-42.
[16] Flamini G, Tebano M, Cioni PL, Ceccarini L, Ricci AS, Longo I. Comparison between the conventional method of extraction of essential oil of Laurus nobilis L. and a novel method which uses microwaves applied in situ, without resorting to an oven. J Chromatogr A 2007; 1143(1-2): 36-40.
[http://dx.doi.org/10.1016/j.chroma.2007.01.031] [PMID: 17239898]
[17] Safwat S, Ishak RAH, Hathout RM, Mortada ND. Nanostructured lipid carriers loaded with simvastatin: Effect of PEG/glycerides on characterization, stability, cellular uptake efficiency and in vitro cytotoxicity Drug Dev Ind Pharm 2017; 0(0): 000.
[http://dx.doi.org/10.1080/03639045.2017.1293681]
[18] Woranuch S, Yoksan R. Eugenol-loaded chitosan nanoparticles: I. Thermal stability improvement of eugenol through encapsulation. Carbohydr Polym 2013; 96(2): 578-85.
[http://dx.doi.org/10.1016/j.carbpol.2012.08.117] [PMID: 23768603]
[19] Mag P, Derakhshan S, Sattari M, Bigdeli M. Effect of cumin (Cuminum cyminum) seed essential oil on bio fi lm formation and plasmid Integrity of Klebsiella pneumoniae. Pharmacogn Mag 2010; 57-62.
[20] Naparstek L, Carmeli Y, Navon-Venezia S, et al. Biofilm formation and susceptibility to gentamicin and colistin of extremely drug-resistant KPC-producing Klebsiella pneumoniae. J Antimicrob Chemother 2014; 69(4): 1027-34.
[http://dx.doi.org/10.1093/jac/dkt487] [PMID: 24408988]
[21] Landman D, Bratu S, Quale J. Contribution of OmpK36 to carbapenem susceptibility in KPC-producing Klebsiella pneumoniae. J Med Microbiol 2009; 58(Pt 10): 1303-8.
[http://dx.doi.org/10.1099/jmm.0.012575-0] [PMID: 19556371]
[22] Kim Y, Lee J, Kim S, Baek K, Lee J. International journal of food microbiology cinnamon bark oil and its components inhibit bio fi lm formation and toxin production. Int J Food Microbiol 2015; 195: 30-9.
[http://dx.doi.org/10.1016/j.ijfoodmicro.2014.11.028] [PMID: 25500277]
[23] Caneiras C, Lito L, Melo-Cristino J, Duarte A. Community- and Hospital-Acquired Klebsiella pneumoniae urinary tract infections in portugal: virulence and antibiotic resistance. Microorganisms 2019; 7(5): 138.
[http://dx.doi.org/10.3390/microorganisms7050138] [PMID: 31100810]
[24] Montso KP, Dlamini SB, Kumar A, Ateba CN. Antimicrobial Resistance Factors of Extended-Spectrum Beta-Lactamases Producing Escherichia coli and Klebsiella pneumoniae Isolated from Cattle Farms and Raw Beef in North-West Province, South Africa. BioMed Res Int 2019; 20194318306
[http://dx.doi.org/10.1155/2019/4318306] [PMID: 31915693]
[25] Aires-de-Sousa M, Ortiz de la Rosa JM, Gonçalves ML, Pereira AL, Nordmann P, Poirel L. Epidemiology of Carbapenemase-Producing Klebsiella pneumoniae in a Hospital, Portugal. Emerg Infect Dis 2019; 25(9): 1632-8.
[http://dx.doi.org/10.3201/eid2509.190656] [PMID: 31441424]
[26] Wu F, Ying Y, Yin M, et al. Molecular characterization of a multidrug-resistant klebsiella pneumoniae strain R46 isolated from a rabbit. International journal of genomics 2019; 2019
[http://dx.doi.org/10.1155/2019/5459190]
[27] Falagas ME, Bliziotis IA, Kasiakou SK, Samonis G, Athanassopoulou P, Michalopoulos A. Outcome of infections due to pandrug-resistant (PDR) Gram-negative bacteria. BMC Infect Dis 2005; 5(1): 24.
[http://dx.doi.org/10.1186/1471-2334-5-24] [PMID: 15819983]
[28] Seifi K, Kazemian H, Heidari H, et al. Evaluation of Biofilm Formation Among Klebsiella pneumoniae Isolates and Molecular Characterization by ERIC-PCR. Jundishapur J Microbiol 2016; 9(1)e30682
[http://dx.doi.org/10.5812/jjm.30682] [PMID: 27099694]
[29] Liu Q, Meng X, Li Y, Zhao CN, Tang GY, Li H. Bin. Antibacterial and antifungal activities of spices. Int J Mol Sci 2017; 18(6): 1-62.
[http://dx.doi.org/10.3390/ijms18061283]
[30] Avcioglu NH, Sahal G, Bilkay IS. ANTIBIOFILM EFFECTS of Citrus limonum and Zingiber officinale Oils on BIOFILM FORMATION of Klebsiella ornithinolytica, Klebsiella oxytoca and Klebsiella terrigena SPECIES. Afr J Tradit Complement Altern Med 2016; 13(6): 61-7.
[http://dx.doi.org/10.21010/ajtcam.v13i6.10] [PMID: 28480361]
[31] Jamil B, Abbasi R, Abbasi S, et al. Encapsulation of Cardamom Essential Oil in Chitosan Nano-composites: In-vitro Efficacy on Antibiotic-Resistant Bacterial Pathogens and Cytotoxicity Studies. Front Microbiol 2016; 7(October): 1580.
[http://dx.doi.org/10.3389/fmicb.2016.01580] [PMID: 27757108]
[32] Tavassoli SK, Mousavi SM, Razavi SH. Chemical composition and evaluation of antimicrobial properties of Rosmarinus officinalis L. essential oil. Afr J Biotechnol 2011; 10(63): 13895-9.
[http://dx.doi.org/10.5897/AJB11.788]
[33] Lammari N, Louaer O, Meniai AH, Elaissari A. Encapsulation of Essential Oils via Nanoprecipitation Process: Overview, Progress, Challenges and Prospects. Pharmaceutics 2020; 12(5): 431.
[http://dx.doi.org/10.3390/pharmaceutics12050431] [PMID: 32392726]
[34] Chouhan S, Sharma K, Guleria S. Antimicrobial Activity of Some Essential Oils-Present Status and Future Perspectives. Medicines (Basel) 2017; 4(3): 1-21.
[PMID: 28930272]
[35] Ma Z, Garrido-Maestu A, Jeong KC. Application, mode of action, and in vivo activity of chitosan and its micro- and nanoparticles as antimicrobial agents: A review. Carbohydr Polym 2017; 176: 257-65.
[http://dx.doi.org/10.1016/j.carbpol.2017.08.082] [PMID: 28927606]
[36] Bai H, You Y, Yan H, et al. Antisense inhibition of gene expression and growth in gram-negative bacteria by cell-penetrating peptide conjugates of peptide nucleic acids targeted to rpoD gene. Biomaterials 2012; 33(2): 659-67.
[http://dx.doi.org/10.1016/j.biomaterials.2011.09.075] [PMID: 22000398]
Track Your Manuscript:


Endorsements



"Open access will revolutionize 21st century knowledge work and accelerate the diffusion of ideas and evidence that support just in time learning and the evolution of thinking in a number of disciplines."


Daniel Pesut
(Indiana University School of Nursing, USA)

"It is important that students and researchers from all over the world can have easy access to relevant, high-standard and timely scientific information. This is exactly what Open Access Journals provide and this is the reason why I support this endeavor."


Jacques Descotes
(Centre Antipoison-Centre de Pharmacovigilance, France)

"Publishing research articles is the key for future scientific progress. Open Access publishing is therefore of utmost importance for wider dissemination of information, and will help serving the best interest of the scientific community."


Patrice Talaga
(UCB S.A., Belgium)

"Open access journals are a novel concept in the medical literature. They offer accessible information to a wide variety of individuals, including physicians, medical students, clinical investigators, and the general public. They are an outstanding source of medical and scientific information."


Jeffrey M. Weinberg
(St. Luke's-Roosevelt Hospital Center, USA)

"Open access journals are extremely useful for graduate students, investigators and all other interested persons to read important scientific articles and subscribe scientific journals. Indeed, the research articles span a wide range of area and of high quality. This is specially a must for researchers belonging to institutions with limited library facility and funding to subscribe scientific journals."


Debomoy K. Lahiri
(Indiana University School of Medicine, USA)

"Open access journals represent a major break-through in publishing. They provide easy access to the latest research on a wide variety of issues. Relevant and timely articles are made available in a fraction of the time taken by more conventional publishers. Articles are of uniformly high quality and written by the world's leading authorities."


Robert Looney
(Naval Postgraduate School, USA)

"Open access journals have transformed the way scientific data is published and disseminated: particularly, whilst ensuring a high quality standard and transparency in the editorial process, they have increased the access to the scientific literature by those researchers that have limited library support or that are working on small budgets."


Richard Reithinger
(Westat, USA)

"Not only do open access journals greatly improve the access to high quality information for scientists in the developing world, it also provides extra exposure for our papers."


J. Ferwerda
(University of Oxford, UK)

"Open Access 'Chemistry' Journals allow the dissemination of knowledge at your finger tips without paying for the scientific content."


Sean L. Kitson
(Almac Sciences, Northern Ireland)

"In principle, all scientific journals should have open access, as should be science itself. Open access journals are very helpful for students, researchers and the general public including people from institutions which do not have library or cannot afford to subscribe scientific journals. The articles are high standard and cover a wide area."


Hubert Wolterbeek
(Delft University of Technology, The Netherlands)

"The widest possible diffusion of information is critical for the advancement of science. In this perspective, open access journals are instrumental in fostering researches and achievements."


Alessandro Laviano
(Sapienza - University of Rome, Italy)

"Open access journals are very useful for all scientists as they can have quick information in the different fields of science."


Philippe Hernigou
(Paris University, France)

"There are many scientists who can not afford the rather expensive subscriptions to scientific journals. Open access journals offer a good alternative for free access to good quality scientific information."


Fidel Toldrá
(Instituto de Agroquimica y Tecnologia de Alimentos, Spain)

"Open access journals have become a fundamental tool for students, researchers, patients and the general public. Many people from institutions which do not have library or cannot afford to subscribe scientific journals benefit of them on a daily basis. The articles are among the best and cover most scientific areas."


M. Bendandi
(University Clinic of Navarre, Spain)

"These journals provide researchers with a platform for rapid, open access scientific communication. The articles are of high quality and broad scope."


Peter Chiba
(University of Vienna, Austria)

"Open access journals are probably one of the most important contributions to promote and diffuse science worldwide."


Jaime Sampaio
(University of Trás-os-Montes e Alto Douro, Portugal)

"Open access journals make up a new and rather revolutionary way to scientific publication. This option opens several quite interesting possibilities to disseminate openly and freely new knowledge and even to facilitate interpersonal communication among scientists."


Eduardo A. Castro
(INIFTA, Argentina)

"Open access journals are freely available online throughout the world, for you to read, download, copy, distribute, and use. The articles published in the open access journals are high quality and cover a wide range of fields."


Kenji Hashimoto
(Chiba University, Japan)

"Open Access journals offer an innovative and efficient way of publication for academics and professionals in a wide range of disciplines. The papers published are of high quality after rigorous peer review and they are Indexed in: major international databases. I read Open Access journals to keep abreast of the recent development in my field of study."


Daniel Shek
(Chinese University of Hong Kong, Hong Kong)

"It is a modern trend for publishers to establish open access journals. Researchers, faculty members, and students will be greatly benefited by the new journals of Bentham Science Publishers Ltd. in this category."


Jih Ru Hwu
(National Central University, Taiwan)


Browse Contents




Webmaster Contact: info@benthamopen.net
Copyright © 2020 Bentham Open