The Open Microbiology Journal




ISSN: 1874-2858 ― Volume 13, 2019

Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections



Hossein Samadi Kafil 1, Ashraf Mohabati Mobarez 2, *
1 Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
2 Department of Medical Bacteriology, Faculty of Medical Science, Tarbiat Modares University, Tehran, Iran

Abstract

Enterococci rank among leading cause of nosocomial bacteremia and urinary tract infection in hospital and community acquired infections. Several traits that may contribute to enhanced virulence have been identified in Enterococci. Extracellular surface protein (Esp) is a virulence factor that contributes in biofilm formation and resistance to environmental stresses. In this study we aimed to determine occurrence of esp in E. faecium and E. faecalis isolates isolated from urinary tract infections and to investigate whether there is any correlation between presence of esp and antibiotic resistance. One hundred and sixty six isolates were collected from patients with UTI and after identification by biochemical and PCR, antibiotic resistances were examined. The presence of esp was investigated by primer-specific PCR. 43.3% of isolates identified as E. faecium and 56.7% as E. faecalis. The esp gene was found in 76.1% of E. faecium isolates and 77.9% of E. faecalis isolate. There were significant correlation between esp positive E. faecium and resistance to Vancomycin (p<0.01), also in E.faecalis we found correlation between esp positive and resistance to Ampicillin, Chloramphenicol and Tetracycline (p<0.01, p<0.01, p<0.01 respectively). Occurrence of esp in our isolates from urinary tract infection was high that indicates importance of this gene in urinary tract infections and shows importance of ability to forming biofilm and hydrophobicity of surface of Enterococci for causing urinary infection by Enterococci. Also, our finding showed significant correlation between resistance to antibiotics and presence of esp in Enterococci.

Keywords: Antibiotic resistance, e. faecium, e. faecalis, esp, urinary tract infection. .


Article Information


Identifiers and Pagination:

Year: 2015
Volume: 9
First Page: 14
Last Page: 17
Publisher Id: TOMICROJ-9-14
DOI: 10.2174/1874285801509010014

Article History:

Received Date: 26/1/2015
Revision Received Date: 21/2/2015
Acceptance Date: 1/3/2015
Electronic publication date: 26/6/2015
Collection year: 2015

Article Metrics:

CrossRef Citations:
0

Total Statistics:

Full-Text HTML Views: 2289
Abstract HTML Views: 1265
PDF Downloads: 288
Total Views/Downloads: 3842

Unique Statistics:

Full-Text HTML Views: 860
Abstract HTML Views: 770
PDF Downloads: 192
Total Views/Downloads: 1822
Geographical View

© Kafil and Mobarez; Licensee Bentham Open.

open-access license: This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.


* Address correspondence to this author at the Department of Medical Bacteriology, Faculty of Medical Science, Tarbiat Modares University, P.O.Box: 14115-111, Tehran, Iran; Tel: +982182883862; Fax: +982182884555; E-mail: mmmobarez@modares.ac.ir




INTRODUCTION

For many years Enterococci species believed to be harmless and considered medically unimportant, because they produce bacteriocins, and they have been used in food industry as starter for dairy products and probiotic [1Foulquié Moreno MR, Sarantinopoulos P, Tsakalidou E , et al. The role and application of enterococci in food and health Int J Food Microbiol 2006; 106: 1-24.], but recently Enterococci have been emerged as an important nosocomial pathogens and are among the most frequently isolated organisms in hospital-acquired infections [2Emori TG, Gaynes RP. An overview of nosocomial infections, including the role of the microbiology laboratory Clin Microbiol Rev 1993; 6: 428-.]. At present Enterococci is known as important nosocomial infections such as endocarditis [3Benes J, Pícha D, Kabelková M , et al. Infective endocarditis caused by unusual gram-positive pathogens Folia Microbiol (Praha) 2002; 47: 737-41.] bacteremia [3Benes J, Pícha D, Kabelková M , et al. Infective endocarditis caused by unusual gram-positive pathogens Folia Microbiol (Praha) 2002; 47: 737-41., 4Vergis EN, Shankar N, Chow JW , et al. Association between the presence of enterococcal virulence factors gelatinase, hemolysin, and enterococcal surface protein and mortality among patients with bacteremia due to Enterococcus faecalis Clin Infect Dis 2002; 35: 570-.] and urinary tract infections [5Zareba T, Hryniewicz W. Clinical significance of Enterococcus infection New Med 1997; 30-.]. The majority of enterococcal infections are caused by E. faecalis. However, in parallel with the increase in nosocomial Enterococci infections, a partial replacement of E. faecalis by E. faecium took place in the world [6Heikens E, Bonten MJ, Willems RJ. Enterococcal surface protein Esp isimportant for biofilm formation of Enterococcus faecium E1162 J Bacteriol 2007; 189: 8233-40., 7Top J, Willems R, van der Velden S , et al. Emergence of clonal complex 17 Enterococcus faecium in The Netherlands J Clin Microbiol 2008; 46: 214-9.]. Little is known about enterococcal properties which make it possible for the bacteria to adhere and colonize the host tissue [8Mundy LM, Sahm DF, Gilmore M. Relationships between enterococcal virulence and antimicrobial resistance Clin Microbiol Rev 2000; 13: 513-22.]. Several traits that may contribute to enhanced virulence have been identified in Enterococci, but better understanding of the virulence of Enterococci is necessary to control further spread and developing new treatment strategies [6Heikens E, Bonten MJ, Willems RJ. Enterococcal surface protein Esp isimportant for biofilm formation of Enterococcus faecium E1162 J Bacteriol 2007; 189: 8233-40.].

Extracellular surface protein (esp) is a cell wall associated protein first described in Enterococcus species by Shankar et al. [9Shankar V, Baghdayan AS, Huycke MM , et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein Infect Immun 1999; 67: 193-200.]. It is thought to promote adhesion, colonization and evasion of the immune system, and to play some role in antibiotic resistance [1Foulquié Moreno MR, Sarantinopoulos P, Tsakalidou E , et al. The role and application of enterococci in food and health Int J Food Microbiol 2006; 106: 1-24.]. It has also contributions in biofilm formation of Enterococci, which lead to resistance to environmental stresses, and adhesion to eukaryotic cells, such as those of the urinary tract [10Borgmann S, Niklas DM, Klare I , et al. Two episodes of vancomycin-resistant Enterococcus faecium outbreaks caused by two genetically different clones in a newborn intensive care unit Int J Hyg Environ Health 2004; 207: 386-9.]. Shankar et al. showed contribution of esp in the persistence of Enterococci in the animal model of urinary tract infections [11Shankar N, Lockatell CV, Baghdayan AS , et al. Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection Infect Immun 2001; 69: 4366-72.]. In this study we aimed to determine presence of esp gene in E. faecium and E. faecalis isolated from urinary tract infections and to investigate any relationship between presence of esp gene and rate of antibiotic resistance.

MATERIALS AND METHODS

Study Design

One hundred and sixty six clinical isolates of Enterococci were collected from patients with urinary tract infections. The isolates were identified as Enterococci and specified by biochemical tests [12Kafil HS, Asgharzadeh M. Vancomycin-resistant enterococcus faecium and enterococcus faecalis isolated from education hospital of iran Maedica J Clin Med 2014; 9: 323-7.]. Identification was confirmed by Mass Spectrophotometer (MALDI-TOF MS microflex, 2012 bruker, Germany) and PCR (as described below). Antibiotic resistance properties of strains were examined by kerby-bauer method according to CLSI guideline (CLSI M100-S24) [13CLSI M100-S24 Performance standard for antimicrobial susceptibility testing Twenty-second informational Supplement 2014; 32(1)].

DNA Extraction and PCR

DNA extraction was done by CinnapureTM DNA extraction kit (Cinnagen, Iran). Briefly, bacterial pellet was resuspended in 100 µl gram positive prelysis buffer and added 20 µl lysosyme and incubated at 37°C for at least 30 min. After adding lysis buffer and precipitation solution, the solution was transferred to a spin column and after washing the spin, DNA was eluted by elution buffer in 65°C [14Kafil HS, Mobarez AM, Moghadam MF. Adhesion and virulence factor properties of Enterococci isolated from clinical samples in Iran Ind J Pathol Microbiol 2013; 56: 238-42.]. PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [15Kariyama R, Mitsuhata R, Chow JW , et al. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant enterococci J Clin Microbiol 2000; 38: 3092-5.], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [16Cheng S, McCleskey FK, Gress MJ , et al. A PCR assay for identification of Enterococcus faecium J Clin Microbiol 1997; 35: 1248-50.] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [9Shankar V, Baghdayan AS, Huycke MM , et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein Infect Immun 1999; 67: 193-200.] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran). DNA was amplified by general PCR. An initial denaturation of 10 min at 94°C was followed by 35 cycles of denaturation at 94°C (1 min), annealing at 58°C for 1 min and extension at 72°C for 1 min, followed by a final extension at 72°C for 10 min. product length were 941bp for E. faecalis, 658bp for E. faecium and 95bp for esp. Positive control for PCR were E. faecalis MMH594 (also esp positive), E. faecalis 29212, E. faecium C38 and C68. Negative controls consisted of the PCR components on reaction mixtures lacking Enterococci DNA. PCR products were electrophoreses in 1.5% agarose gels and after staining with 0.5µg/ml ethidium bromide visualized under UV light. The size of fragments was determined in comparision with 100bp DNA ladder plus size marker (Fermentas., Germany).

Statistical Analysis

Chi-square test (or Fisher exact test) was performed for data analysis. P values below 0.05 were considered to be significant. Statistical analysis was done by Spss. 21 software.

Results

From 166 clinical isolates of urinary tract infections of Enterococci, 59.7% of isolates were from females and 40.3% from males. By biochemical differentiation and PCR for specific genes, 43.3% of isolates were identified as E. faecium and 56.7% as E. faecalis. Antibiotic resistance of strain described by disc diffusion (Figs. 1 and 2) and the presence of esp gene was identified in 77.1% of all isolates of Enterococci. esp gene was identified in 76.1% of E. faecium and 77.9% of E. faecalis isolates (Fig. 3). There was not any significant difference between presence of esp gene in E. faecalis and E. faecium isolates (P> 0.05). Correlation of resistance to antibiotic and presence of the esp genes was investigated. In E. feacium, correlation was found between presence of the esp and resistance to Vancomycin (p<0.01) (Fig. 1). In E. faecalis we revealed correlation between resistance to Ampicillin, Chloramphenicol and Tetracycline (p<0.01, p<0.01 and p= 0.006 respectively) and presence of esp gene (Fig. 2).

Fig. (1)

E. faecium Antibiotic resistance properties in Total and Esp positive strains. Sens: Sensitive; int: intermediate; res: resistance.



Fig. (2)

E.faecalis Antibiotic resistance properties in Total and Esp positive strains. Sens: Sensitive; int: intermediate; res: resistance.



Fig. (3)

PCR amplification and screening of Sample for presence of genome. Numbers intended in pictures are patients' numbers and have not any meaning. Positive controls were E. faecalis 29212 (Standard for E.faecalis), E. faecium C38 (Standard for E. faecium) and E. faecalis MMH594 (Standard for esp).



DISCUSSION

In the previous studies, several investigators have focused on the relationship between Enterococciesp gene and antibiotic resistance. The current investigation examined the relationship of Enterococciesp gene with antibiotic resistance of isolates from in the urinary tract infection. In this study we investigated the presence of esp in E. faecium and E. faecalis isolates from urinary tract infection. Enterococcal surface protein (esp) is considered as virulence factor in Enterococci, a few studies have done on presence and importance of esp on urinary tract infection of Enterococci. esp has been identified in E. faecium and E. faecalis previously [17Eaton TJ, Gasson MJ. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates Appl Environ Microbiol 2001; 67: 1628-35.], but not in other Enterococci [18Dworniczek E, Kuzko K, Mróz E , et al. Virulence factors and in vitro adherence of Enterococcus strains to urinary catheters Folia Microbiol (Praha) 2003; 48: 671-8.]. We revealed high frequency of esp genes in both E. faecium and E. faecalis (76.1%, 77.9% respectively) isolated from urinary tract infection. It was higher rate than reported in previous studies on clinical samples [17Eaton TJ, Gasson MJ. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates Appl Environ Microbiol 2001; 67: 1628-35., 19Hammerum AM, Jensen LB. Prevalence of esp, encoding the enterococcal surface protein, in Enterococcus faecalis and Enterococcus faecium isolates from hospital patients, poultry, and pigs in Denmark J Clin Microbiol 2002; 40: 4396.]. esp has been reported as the first important gene for biofilm formation in Enterococci [6Heikens E, Bonten MJ, Willems RJ. Enterococcal surface protein Esp isimportant for biofilm formation of Enterococcus faecium E1162 J Bacteriol 2007; 189: 8233-40., 9Shankar V, Baghdayan AS, Huycke MM , et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein Infect Immun 1999; 67: 193-200.]. The ability to form biofilm on abiotic surfaces is considered to be an important virulence property of the Enterococci [20Donelli G, Guaglianone E. Emerging role of Enterococcus spp in catheter-related infections biofilm formation and novel mechanisms of antibiotic resistance J Vasc Access 2004; 5: 3-9.], biofilm is an assemblage of microbial cells associated with a surface and enclosed in a matrix of primarily polysaccharide material [16Cheng S, McCleskey FK, Gress MJ , et al. A PCR assay for identification of Enterococcus faecium J Clin Microbiol 1997; 35: 1248-50.]. Defined architecture of the biofilm provides an optimal environment for the exchange of genetic material between bacteria and increases the innate resistance of the bacterium to antibiotic and activities of the host immune response [6Heikens E, Bonten MJ, Willems RJ. Enterococcal surface protein Esp isimportant for biofilm formation of Enterococcus faecium E1162 J Bacteriol 2007; 189: 8233-40., 21Donlan RM. Biofilms microbial life on surfaces Emerg Infect Dis 2002; 8: 881-90.]. esp gene positive isolates were considered as expressing the esp protein [9Shankar V, Baghdayan AS, Huycke MM , et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein Infect Immun 1999; 67: 193-200., 22Waar K, Muscholl-Silberhorn AB, Willems RJ , et al. Genogrou-ping and incidence of virulence factors of Enterococcus faecalis in liver transplant patients differ from blood culture and fecal isolates J Infect Dis 2002; 185: 1121-7.]. Results of this study shows importance of the biofilm formation and the presence of esp in clinical samples, especially in the urinary tract infections. The nature of urinary tract infections necessitate biofilm for bacteria, and presence of esp in most of urinary cultured Enterococci endorse importance of this gene for survival of bacteria in urinary tract. It has been also demonstrated that esp increased the hydrophobicity of bacterial surface [23Toledo-Arana A, Valle J, Solano C , et al. he enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation Appl Environ Microbiol 2001; 67: 4538-.]. Therefore, it can help Enterococci to match with urinary tract condition.

In this study, we found significant correlation between the presence of esp and the antibiotic resistance. Our data showed significant correlation between presence of esp gene and resistance to Vancomycin in E. faecium (Fig. 1) and resistance to Ampicillin, Chloramphenicol and Tetracycline (p<0.001, p<0.001, p<0.001) (Fig. 2) in E. faecalis. In a study by Billstrom et al, they revealed strong correlation between esp carriage and antimicrobial resistance to Ampicillin and Ciprofloxacin and Imipenem in clinical blood culture isolates of E. faecium [24Billström H, Lund B, Sullivan A , et al. irulence and antimicrobial resistance in clinical Enterococcus faecium Int J Antimicrob Agents 2008; 32: 374-7.]. But in our urinary tract isolates of E. faecium, we didn’t find similar correlation (Fig. 1). However, we found significant correlation with resistance to Vancomycin and presence of esp. Also in E. faecalis isolates we had significant correlation between the presence of esp and resistance to the Ampicillin, Tetracycline and Chloramphenicol (Fig. 2).

In conclusion, our finding provides additional evidence for the presence of esp in Enterococcus isolates from urinary tract infection and high rate of antibiotic resistance may lead to strong biofilm formers and strong adherent to host cells. These three factors may play an important role in enterococcal infections. The presence of these bacteria in urinary tract infection in addition to its multi resistance, close attention should be given to these strains in order to reduce risk for development of disease caused by Enterococci in other areas of the body. Furthermore, additional studies about role of esp expression on biofilm formation of enterococci is needed.

CONFLICT OF INTEREST

The authors confirm that this article content has no conflict of interest.

ACKNOWLEDGMENTS

We would like to thank all staff of educational hospitals for cooperation in collecting samples and antibiogram of isolates. Also we thank Dr. Hossein Navidinia for their helpful comments on manuscript.

FUNDING

This study was granted by Iran National Elite foundation for Hossein Samadi Kafil.

REFERENCES

[1] Foulquié Moreno MR, Sarantinopoulos P, Tsakalidou E , et al. The role and application of enterococci in food and health Int J Food Microbiol 2006; 106: 1-24.
[2] Emori TG, Gaynes RP. An overview of nosocomial infections, including the role of the microbiology laboratory Clin Microbiol Rev 1993; 6: 428-.
[3] Benes J, Pícha D, Kabelková M , et al. Infective endocarditis caused by unusual gram-positive pathogens Folia Microbiol (Praha) 2002; 47: 737-41.
[4] Vergis EN, Shankar N, Chow JW , et al. Association between the presence of enterococcal virulence factors gelatinase, hemolysin, and enterococcal surface protein and mortality among patients with bacteremia due to Enterococcus faecalis Clin Infect Dis 2002; 35: 570-.
[5] Zareba T, Hryniewicz W. Clinical significance of Enterococcus infection New Med 1997; 30-.
[6] Heikens E, Bonten MJ, Willems RJ. Enterococcal surface protein Esp isimportant for biofilm formation of Enterococcus faecium E1162 J Bacteriol 2007; 189: 8233-40.
[7] Top J, Willems R, van der Velden S , et al. Emergence of clonal complex 17 Enterococcus faecium in The Netherlands J Clin Microbiol 2008; 46: 214-9.
[8] Mundy LM, Sahm DF, Gilmore M. Relationships between enterococcal virulence and antimicrobial resistance Clin Microbiol Rev 2000; 13: 513-22.
[9] Shankar V, Baghdayan AS, Huycke MM , et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein Infect Immun 1999; 67: 193-200.
[10] Borgmann S, Niklas DM, Klare I , et al. Two episodes of vancomycin-resistant Enterococcus faecium outbreaks caused by two genetically different clones in a newborn intensive care unit Int J Hyg Environ Health 2004; 207: 386-9.
[11] Shankar N, Lockatell CV, Baghdayan AS , et al. Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection Infect Immun 2001; 69: 4366-72.
[12] Kafil HS, Asgharzadeh M. Vancomycin-resistant enterococcus faecium and enterococcus faecalis isolated from education hospital of iran Maedica J Clin Med 2014; 9: 323-7.
[13] CLSI M100-S24 Performance standard for antimicrobial susceptibility testing Twenty-second informational Supplement 2014; 32(1)
[14] Kafil HS, Mobarez AM, Moghadam MF. Adhesion and virulence factor properties of Enterococci isolated from clinical samples in Iran Ind J Pathol Microbiol 2013; 56: 238-42.
[15] Kariyama R, Mitsuhata R, Chow JW , et al. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant enterococci J Clin Microbiol 2000; 38: 3092-5.
[16] Cheng S, McCleskey FK, Gress MJ , et al. A PCR assay for identification of Enterococcus faecium J Clin Microbiol 1997; 35: 1248-50.
[17] Eaton TJ, Gasson MJ. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates Appl Environ Microbiol 2001; 67: 1628-35.
[18] Dworniczek E, Kuzko K, Mróz E , et al. Virulence factors and in vitro adherence of Enterococcus strains to urinary catheters Folia Microbiol (Praha) 2003; 48: 671-8.
[19] Hammerum AM, Jensen LB. Prevalence of esp, encoding the enterococcal surface protein, in Enterococcus faecalis and Enterococcus faecium isolates from hospital patients, poultry, and pigs in Denmark J Clin Microbiol 2002; 40: 4396.
[20] Donelli G, Guaglianone E. Emerging role of Enterococcus spp in catheter-related infections biofilm formation and novel mechanisms of antibiotic resistance J Vasc Access 2004; 5: 3-9.
[21] Donlan RM. Biofilms microbial life on surfaces Emerg Infect Dis 2002; 8: 881-90.
[22] Waar K, Muscholl-Silberhorn AB, Willems RJ , et al. Genogrou-ping and incidence of virulence factors of Enterococcus faecalis in liver transplant patients differ from blood culture and fecal isolates J Infect Dis 2002; 185: 1121-7.
[23] Toledo-Arana A, Valle J, Solano C , et al. he enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation Appl Environ Microbiol 2001; 67: 4538-.
[24] Billström H, Lund B, Sullivan A , et al. irulence and antimicrobial resistance in clinical Enterococcus faecium Int J Antimicrob Agents 2008; 32: 374-7.

Endorsements



"Open access will revolutionize 21st century knowledge work and accelerate the diffusion of ideas and evidence that support just in time learning and the evolution of thinking in a number of disciplines."


Daniel Pesut
(Indiana University School of Nursing, USA)

"It is important that students and researchers from all over the world can have easy access to relevant, high-standard and timely scientific information. This is exactly what Open Access Journals provide and this is the reason why I support this endeavor."


Jacques Descotes
(Centre Antipoison-Centre de Pharmacovigilance, France)

"Publishing research articles is the key for future scientific progress. Open Access publishing is therefore of utmost importance for wider dissemination of information, and will help serving the best interest of the scientific community."


Patrice Talaga
(UCB S.A., Belgium)

"Open access journals are a novel concept in the medical literature. They offer accessible information to a wide variety of individuals, including physicians, medical students, clinical investigators, and the general public. They are an outstanding source of medical and scientific information."


Jeffrey M. Weinberg
(St. Luke's-Roosevelt Hospital Center, USA)

"Open access journals are extremely useful for graduate students, investigators and all other interested persons to read important scientific articles and subscribe scientific journals. Indeed, the research articles span a wide range of area and of high quality. This is specially a must for researchers belonging to institutions with limited library facility and funding to subscribe scientific journals."


Debomoy K. Lahiri
(Indiana University School of Medicine, USA)

"Open access journals represent a major break-through in publishing. They provide easy access to the latest research on a wide variety of issues. Relevant and timely articles are made available in a fraction of the time taken by more conventional publishers. Articles are of uniformly high quality and written by the world's leading authorities."


Robert Looney
(Naval Postgraduate School, USA)

"Open access journals have transformed the way scientific data is published and disseminated: particularly, whilst ensuring a high quality standard and transparency in the editorial process, they have increased the access to the scientific literature by those researchers that have limited library support or that are working on small budgets."


Richard Reithinger
(Westat, USA)

"Not only do open access journals greatly improve the access to high quality information for scientists in the developing world, it also provides extra exposure for our papers."


J. Ferwerda
(University of Oxford, UK)

"Open Access 'Chemistry' Journals allow the dissemination of knowledge at your finger tips without paying for the scientific content."


Sean L. Kitson
(Almac Sciences, Northern Ireland)

"In principle, all scientific journals should have open access, as should be science itself. Open access journals are very helpful for students, researchers and the general public including people from institutions which do not have library or cannot afford to subscribe scientific journals. The articles are high standard and cover a wide area."


Hubert Wolterbeek
(Delft University of Technology, The Netherlands)

"The widest possible diffusion of information is critical for the advancement of science. In this perspective, open access journals are instrumental in fostering researches and achievements."


Alessandro Laviano
(Sapienza - University of Rome, Italy)

"Open access journals are very useful for all scientists as they can have quick information in the different fields of science."


Philippe Hernigou
(Paris University, France)

"There are many scientists who can not afford the rather expensive subscriptions to scientific journals. Open access journals offer a good alternative for free access to good quality scientific information."


Fidel Toldrá
(Instituto de Agroquimica y Tecnologia de Alimentos, Spain)

"Open access journals have become a fundamental tool for students, researchers, patients and the general public. Many people from institutions which do not have library or cannot afford to subscribe scientific journals benefit of them on a daily basis. The articles are among the best and cover most scientific areas."


M. Bendandi
(University Clinic of Navarre, Spain)

"These journals provide researchers with a platform for rapid, open access scientific communication. The articles are of high quality and broad scope."


Peter Chiba
(University of Vienna, Austria)

"Open access journals are probably one of the most important contributions to promote and diffuse science worldwide."


Jaime Sampaio
(University of Trás-os-Montes e Alto Douro, Portugal)

"Open access journals make up a new and rather revolutionary way to scientific publication. This option opens several quite interesting possibilities to disseminate openly and freely new knowledge and even to facilitate interpersonal communication among scientists."


Eduardo A. Castro
(INIFTA, Argentina)

"Open access journals are freely available online throughout the world, for you to read, download, copy, distribute, and use. The articles published in the open access journals are high quality and cover a wide range of fields."


Kenji Hashimoto
(Chiba University, Japan)

"Open Access journals offer an innovative and efficient way of publication for academics and professionals in a wide range of disciplines. The papers published are of high quality after rigorous peer review and they are Indexed in: major international databases. I read Open Access journals to keep abreast of the recent development in my field of study."


Daniel Shek
(Chinese University of Hong Kong, Hong Kong)

"It is a modern trend for publishers to establish open access journals. Researchers, faculty members, and students will be greatly benefited by the new journals of Bentham Science Publishers Ltd. in this category."


Jih Ru Hwu
(National Central University, Taiwan)


Browse Contents



Webmaster Contact: info@benthamopen.net
Copyright © 2019 Bentham Open