The Open Virology Journal




ISSN: 1874-3579 ― Volume 13, 2019

Phylogenesis and Clinical Aspects of Pandemic 2009 Influenza A (H1N1) Virus Infection



Massimo Ciccozzi 1, Muhammed Babakir-Mina 2, 3, Alessandra Lo Presti 1, Fabbio Marcuccilli 2, Carlo Federico Perno 2, 3, Marco Ciotti*, 2
1 Department of Infectious, Parasitic and Immunomediated Diseases, Istituto Superiore di Sanita’, Rome, Italy
2 Laboratory of Molecular Virology, Foundation Polyclinic Tor Vergata, Viale Oxford, 81- 00133, Rome, Italy
3 Virology, Department of Experimental Medicine and Biochemistry, Tor Vergata University, Rome, Italy

Abstract

During the spring of 2009, a new influenza A (H1N1) virus of swine origin emerged and spread worldwide causing a pandemic influenza. Here, 329 naso-pharyngeal swabs collected from patients with flu-like symptoms were analyzed by real-time PCR for the presence of H1N1 2009 pandemic virus. Twenty-five samples collected from immunocompetent and immunodepressed patients contained the H1N1 pandemic virus. Phylogenetic analysis of the hemagglutinin and neuraminidase genes showed no obvious differences in terms of similarity and/or homology between the sequences identified in immunocompetent individuals and those obtained from immunocompromised patients. Pre-existing clinical conditions may influence the outcome of H1N1 disease.

Keywords: H1N1 pandemic virus, swine flu, respiratory infections, phylogenetic analysis, influenza surface antigens..


Article Information


Identifiers and Pagination:

Year: 2011
Volume: 5
First Page: 22
Last Page: 26
Publisher Id: TOVJ-5-22
DOI: 10.2174/1874357901105010022

Article History:

Received Date: 29/7/2010
Revision Received Date: 6/10/2010
Acceptance Date: 6/10/2010
Electronic publication date: 7/4/2011
Collection year: 2011

Article Metrics:

CrossRef Citations:
0

Total Statistics:

Full-Text HTML Views: 1128
Abstract HTML Views: 877
PDF Downloads: 202
Total Views/Downloads: 2207

Unique Statistics:

Full-Text HTML Views: 634
Abstract HTML Views: 559
PDF Downloads: 133
Total Views/Downloads: 1326
Geographical View

© Ciccozzi et al.; Licensee Bentham Open.

open-access license: This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (http: //creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.


* Address correspondence to this author at the Laboratory of Molecular Virology, Foundation Polyclinic Tor Vergata, Viale Oxford, 81-00133, Rome, Italy; Tel.: +39 06 20902087; Fax: +39 06 20902078; E-mail: marco.ciotti@ptvonline.it




INTRODUCTION

In the early spring of 2009, Mexico and the United States reported clusters of human pneumonia cases caused by a novel H1N1 influenza A virus. This virus spread subsequently across the globe at an unprecedented rate, prompting the WHO to declare a pandemic in June 2009. Phylogenetic analysis has inferred that the virus is likely a reassortant between a North American triple-reassortant swine H1N1 or H1N2 virus and a Eurasian lineage H1N1 swine influenza virus [1Dawood FS, Jain S, Finelli L, et al. Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team, Emergence of a novel swine-origin influenza A (H1N1) virus in humans N Engl J Med 2009; 360: 2605-15., 2Garten RJ, Davis CT, Russell CA, et al. Antigenic and genetic characteristics of swine-origin 2009 (H1N1) influenza viruses circulating in humans Science 2009; 325: 197-201.]. The analysis showed that the H1 of this reassortant originated from American pigs, while NA and MP were more likely from European pigs. All of the 2009 isolates appear homogeneous and cluster together, although they are distinct from classical human A (H1N1) viruses [3Babakir-Mina M, Dimonte S, Perno CF, Ciotti M. Origin of the 2009 Mexico influenza virus: a comparative phylogenetic analysis of the principal external antigens and matrix protein Arch Virol 2009; 154: 1349-52.]. Bayesian molecular-clock analysis of each gene of this novel H1N1 virus [4Smith GJD, Vijaykrishna D, Bahl J, et al. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza an epidemic Nature 2009; 459: 1122-5.] concluded that the mean evolutionary rate is typical of that of swine influenza viruses, but that the duration of unsampled diversity for each gene segment had means that ranged from 9.24 to 17.15 years, suggesting that the proposed ancestors of this virus may have been circulating undetected for nearly a decade. Inadequate surveillance and characterization of influenza A viruses that circulate in swine have been blamed for this evolutionary gap. Also a recent study showed that the domestic birds could act as intermediate hosts of H1N1 reassortants [5Babakir-Mina M, Dimonte S, Ciccozzi M, Perno CF, Ciotti M. The novel swine-origin H1N1 influenza A virus riddle: Is it a domestic bird H1N1-derived virus? New Microbiol 2010; 33: 77-81.]. Multiple genetic groups have been recognized, including one recently predominant lineage [6Valli MB, Meschi S, Selleri M, et al. Evolutionary pattern of pandemic influenza (H1N1) 2009 virus in the late phases of the 2009 pandemic PLoS Curr Influenza 2010; 3: RRN1149.], but any possible clinical importance of different lineages remains uncertain. To date, reassortment has not occurred with human influenza viruses. The level of pulmonary replication of the 2009 H1N1 virus has been higher than that of seasonal influenza A (H1N1) viruses in animals infected experimentally [7Maines TR, Jayaraman A, Belser JA, et al. Transmission and pathogenesis of swine-origin 2009 A (H1N1) influenza viruses in ferrets and mice Science 2009; 325: 484-7.-9Munster VJ, De Wit E, Van den Brand JM, et al. Pathogenesis and transmission of swine-origin 2009 A(H1N1) influenza virus in ferrets Science 2009; 325: 481-3.], but the 2009 pandemicstrain generally lacks mutations that are associated with increased pathogenicity in other influenza viruses [10Padlan EA. The pandemic 2009 (H1N1) swine influenza virus is mild compared to the pandemic 1918 (H1N1) virus because of a proline-to-serine substitution in the receptor-binding site of its hemagglutinin - a hypothesis Med Hypotheses 2010; 74: 240-1.].

Here, a phylogenetic study was carried out on the H1N1 2009 pandemic viruses isolated from immunocompetent and immunocompromised patients admitted at Tor Vergata hospital for flu-like symptoms. Influenza-like illness was defined as the presence of fever >38º C and at least another constitutional symptom (asthenia, headache, malaise, sweating, and chills) and one respiratory symptom (cough, sore throat, nasal congestion).

From September 2009 through March 2010, 329 naso-pharyngeal swabs were collected from patients (127 females and 202 males) admitted at the Polyclinic Tor Vergata for flu-like symptoms. Patient’s age ranged from 1 to 93 years old. The specimens were analysed at the Laboratory of Molecular Virology, Foundation Polyclinic Tor Vergata, Rome, Italy, for the presence of influenza viruses type A and B.

Viral RNA was extracted with the QIAamp RNA mini kit according to the manufacturer’s instruction (QIAGEN S.P.A., Milan, Italy). The RNA was eluted in a volume of 60 µl and stored at 80°- C until analysis. The influenza virus was detected by qualitative real-time PCR using the Influenza virus A/B assay (Cepheid, Sunnyvalle, CA, USA) run on the SmartCycler platform (Cepheid, Sunnyvalle, CA, USA). Influenza A positive cases were re-amplified with primers targeting the hemaglutinin (HA) and neuraminidase (NA) genes of influenza A (H1N1) 2009 pandemic virus. The primer sequences were as follows: F-HA 5’- TGGGGCCATTGCCGGTTTCA-3’ (nucleotide position 1041-1060) and R-HA 5’TGCCCCCAGGGAGACTACCA -3’ (nucleotide position 1647–1628); F-NA 5’-GCCCAGACAAT GGGGCAGTGG-3’ (nucleotide position 590-610) and R-NA 5’-CCGTCTGGCCAAGACCAACCC-3’ (nucleotide position 1379-1359). Reverse-transcription and amplification was carried out using the OneStep RT-PCR Kit according to the manufacturer’s instructions (QIAGEN S S.P.A., Milan, Italy).

The PCR products were analyzed on a 2% agarose gel stained with ethidium bromide and visualized under ultraviolet light. All the necessary precautions were taken to avoid contamination.

The HA and NA amplified fragments were sequenced using the Genome Lab DTCS Quick Start Kit (Beckman Coulter, Fullerton, CA, USA) and run on a Beckman Coulter CEQ 8000 Genetic Analysis System (Fullerton, CA, USA) after column purification. The obtained sequences were submitted to the Genbank and matched against all deposited sequences (http://www.ncbi.nlm.nih.gov/BLAST).

An alignment with a set of reference sequences was obtained using CLUSTAL X [11Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 1994; 25: 4876-82.] and manually edited with the Bioedit software [12Hall TA. Bioedit: a user-friendly biological sequence alignment, editor and analysis program for Windows 95/98 NT Nucleic Acids Symp Ser 199; 41: 95-8.]. The evolutionary model was chosen as the best-fitting nucleotide substitution model, according to the Hierarchical Likelihood Ratio Test (HLRT) implemented in the Model Test V3.0 software [13Posada D, Crandall KA. MODEL TEST: Testing the model of DNA substitution Bioinformatics 1998; 14: 817-.]. The statistical robustness and reliability of the branching order within each phylogenetic tree were confirmed by bootstrap analysis using 1000 replicates for the NJ tree and with the Zero Branch Length Test for the Maximum Likelihood (ML) tree. All calculations were performed with PAUP*4.0 software [14Swofford D, Sullivan J. The phylogenetic handbook-A practical approach to DNA and protein phylogeny. New York: Cambridge University Press 2003; pp. 160-206.]. Trees were rooted as mid point root. The accession numbers of the sequences utilized for phylogenetic analysis including those referred to influenza A virus (H1N1) strains identified in our laboratory and labelled A/ROME/PTV1 to 25 are reported in Appendix Table 1.

Table 1.

Clinical and Demographic Characteristics of the 25 Italian Patients Infected with the Pandemic H1N1 Influenza Virus




Twenty-five H1N1 2009 pandemic viruses were identified. Of these, six were from immunodepressed patients (five with hematological malignancies and one HIV-1 infected) and nineteen from immunocompetent individuals (Table 1). A Maximum Likelihood phylogenetic tree was generated for the HA and NA genes (Figs. 1, 2). In the HA tree, a main clade was generated where the strains collected from Italian immunodepressed patients and Indian fatal cases [15Potdar VA, Chadha MS, Jadhav SM, et al. Genetic characterization of the Influenza A pandemic (H1N1) 2009 virus isolates from India PLoS ONE 2010; 5: e9693.] (in bold) intermixed with those obtained from immunocompetent Italian patients or Indian recovered cases (regular font). This is clearly shown by the strains A/Pune/NIV10278/2009 and A/Pune/NIV9355/2009 obtained from two fatal cases which cluster with the strain A/Blore/NIV236/2009 isolated from a recovered patient; and outside the main clade, by the strain A/Rome/PTV24/2010 isolated from an immunocompromised patient which clusters with the strain A/Rome/PTV12/2010 and A/Rome/PTV23/2010 obtained from immunocompetent individuals. Both clusters are statistically supported. A similar picture was observed with the NA tree (Fig. 2). Even in this case the viral strains from immunocompromised or death patients intermixed with those isolated from immucompetent patients with the exception of two small clusters (A/Pune/NIV10604/2009, A/Pune/NIV6196/ 2009 and A/Rome/PTV8/2010, A/Rome/PTV9/2010) which were collected from two fatal cases and immunocompromised patients, respectively.

Fig. (1)

Maximun likelihood phylogenetic analysis of H1N1 HA sequences. The data set included sequences isolated from patients admitted at Tor Vergata hospital. The tree was rooted by using the midpoint rooting method. Branch lengths were estimated with the best fitting nucleotide substitution model (HKY+I+G) according to a hierarchical likelihood ratio test, and were drawn to scale with the bar at the bottom indicating 0.0090 nucleotide substitutions per site. One asterisk (*) along a branch represents significant statistical support for the clade subtending that branch (p<0.001 in the zero-branch-length test and bootstrap support >75%). The strains isolated from severe cases are in bold.



Fig. (2)

Maximun likelihood phylogenetic analysis of H1N1 NA sequences. The data set included sequences isolated from patients admitted at Tor Vergata hospital. The tree was rooted by using the midpoint rooting method. Branch lengths were estimated with the best fitting nucleotide substitution model (HKY+I+G) according to a hierarchical likelihood ratio test, and were drawn to scale with the bar at the bottom indicating 0.04 nucleotide substitutions per site. One asterisk (*) along a branch represents significant statistical support for the clade subtending that branch (p<0.001 in the zero-branch-length test and bootstrap support .>75%). The strains isolated from severe cases are in bold.



The results of this study indicate no obvious differences in viral sequences between the H1N1 pandemic viruses isolated from immunocompetent individuals and those identified in recovered immunocompromised patients and/or fatal cases. We can exclude that the lack of sequence variations observed in Italian immunocompetent and immunocompromised patients was due to contamination of virus sequences since the samples and sequencing were handled appropriately using separate rooms and including controls in each run as also shown by the phylogenetic trees.

Indeed, mutations that have been linked to fatal cases have also been detected in recovered cases [15Potdar VA, Chadha MS, Jadhav SM, et al. Genetic characterization of the Influenza A pandemic (H1N1) 2009 virus isolates from India PLoS ONE 2010; 5: e9693., 16Puzelli S, Facchini M, Spagnolo D, et al. Transmission of hemagglutinin D222G mutant strain of pandemic (H1N1) 2009 virus Emerg Infect Dis 2010; 5: 863-5.]; therefore their role in viral pathogenesis remains unclear. Preexisting specific severe clinical conditions may play an important role in determining the outcome of H1N1disease [17Writing Committee of the WHO Consultation on Clinical Aspects of Pandemic (H1N1) 2009 Influenza. Clinical aspects of pandemic 2009 influenza A (H1N1) virus infection N Engl J Med 2010; 362: 1708-9.].

APPENDIX

Table A1.

H1N1 2009 Pandemic Virus Sequences Used in this Study




REFERENCES

[1] Dawood FS, Jain S, Finelli L, et al. Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team, Emergence of a novel swine-origin influenza A (H1N1) virus in humans N Engl J Med 2009; 360: 2605-15.
[2] Garten RJ, Davis CT, Russell CA, et al. Antigenic and genetic characteristics of swine-origin 2009 (H1N1) influenza viruses circulating in humans Science 2009; 325: 197-201.
[3] Babakir-Mina M, Dimonte S, Perno CF, Ciotti M. Origin of the 2009 Mexico influenza virus: a comparative phylogenetic analysis of the principal external antigens and matrix protein Arch Virol 2009; 154: 1349-52.
[4] Smith GJD, Vijaykrishna D, Bahl J, et al. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza an epidemic Nature 2009; 459: 1122-5.
[5] Babakir-Mina M, Dimonte S, Ciccozzi M, Perno CF, Ciotti M. The novel swine-origin H1N1 influenza A virus riddle: Is it a domestic bird H1N1-derived virus? New Microbiol 2010; 33: 77-81.
[6] Valli MB, Meschi S, Selleri M, et al. Evolutionary pattern of pandemic influenza (H1N1) 2009 virus in the late phases of the 2009 pandemic PLoS Curr Influenza 2010; 3: RRN1149.
[7] Maines TR, Jayaraman A, Belser JA, et al. Transmission and pathogenesis of swine-origin 2009 A (H1N1) influenza viruses in ferrets and mice Science 2009; 325: 484-7.
[8] Itoh Y, Shinya K, Kiso M, et al. In vitro and in vivo characterization of new swine- origin H1N1 influenza viruses Nature 2009; 460: 1021-5.
[9] Munster VJ, De Wit E, Van den Brand JM, et al. Pathogenesis and transmission of swine-origin 2009 A(H1N1) influenza virus in ferrets Science 2009; 325: 481-3.
[10] Padlan EA. The pandemic 2009 (H1N1) swine influenza virus is mild compared to the pandemic 1918 (H1N1) virus because of a proline-to-serine substitution in the receptor-binding site of its hemagglutinin - a hypothesis Med Hypotheses 2010; 74: 240-1.
[11] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 1994; 25: 4876-82.
[12] Hall TA. Bioedit: a user-friendly biological sequence alignment, editor and analysis program for Windows 95/98 NT Nucleic Acids Symp Ser 199; 41: 95-8.
[13] Posada D, Crandall KA. MODEL TEST: Testing the model of DNA substitution Bioinformatics 1998; 14: 817-.
[14] Swofford D, Sullivan J. The phylogenetic handbook-A practical approach to DNA and protein phylogeny. New York: Cambridge University Press 2003; pp. 160-206.
[15] Potdar VA, Chadha MS, Jadhav SM, et al. Genetic characterization of the Influenza A pandemic (H1N1) 2009 virus isolates from India PLoS ONE 2010; 5: e9693.
[16] Puzelli S, Facchini M, Spagnolo D, et al. Transmission of hemagglutinin D222G mutant strain of pandemic (H1N1) 2009 virus Emerg Infect Dis 2010; 5: 863-5.
[17] Writing Committee of the WHO Consultation on Clinical Aspects of Pandemic (H1N1) 2009 Influenza. Clinical aspects of pandemic 2009 influenza A (H1N1) virus infection N Engl J Med 2010; 362: 1708-9.

Endorsements



"Open access will revolutionize 21st century knowledge work and accelerate the diffusion of ideas and evidence that support just in time learning and the evolution of thinking in a number of disciplines."


Daniel Pesut
(Indiana University School of Nursing, USA)

"It is important that students and researchers from all over the world can have easy access to relevant, high-standard and timely scientific information. This is exactly what Open Access Journals provide and this is the reason why I support this endeavor."


Jacques Descotes
(Centre Antipoison-Centre de Pharmacovigilance, France)

"Publishing research articles is the key for future scientific progress. Open Access publishing is therefore of utmost importance for wider dissemination of information, and will help serving the best interest of the scientific community."


Patrice Talaga
(UCB S.A., Belgium)

"Open access journals are a novel concept in the medical literature. They offer accessible information to a wide variety of individuals, including physicians, medical students, clinical investigators, and the general public. They are an outstanding source of medical and scientific information."


Jeffrey M. Weinberg
(St. Luke's-Roosevelt Hospital Center, USA)

"Open access journals are extremely useful for graduate students, investigators and all other interested persons to read important scientific articles and subscribe scientific journals. Indeed, the research articles span a wide range of area and of high quality. This is specially a must for researchers belonging to institutions with limited library facility and funding to subscribe scientific journals."


Debomoy K. Lahiri
(Indiana University School of Medicine, USA)

"Open access journals represent a major break-through in publishing. They provide easy access to the latest research on a wide variety of issues. Relevant and timely articles are made available in a fraction of the time taken by more conventional publishers. Articles are of uniformly high quality and written by the world's leading authorities."


Robert Looney
(Naval Postgraduate School, USA)

"Open access journals have transformed the way scientific data is published and disseminated: particularly, whilst ensuring a high quality standard and transparency in the editorial process, they have increased the access to the scientific literature by those researchers that have limited library support or that are working on small budgets."


Richard Reithinger
(Westat, USA)

"Not only do open access journals greatly improve the access to high quality information for scientists in the developing world, it also provides extra exposure for our papers."


J. Ferwerda
(University of Oxford, UK)

"Open Access 'Chemistry' Journals allow the dissemination of knowledge at your finger tips without paying for the scientific content."


Sean L. Kitson
(Almac Sciences, Northern Ireland)

"In principle, all scientific journals should have open access, as should be science itself. Open access journals are very helpful for students, researchers and the general public including people from institutions which do not have library or cannot afford to subscribe scientific journals. The articles are high standard and cover a wide area."


Hubert Wolterbeek
(Delft University of Technology, The Netherlands)

"The widest possible diffusion of information is critical for the advancement of science. In this perspective, open access journals are instrumental in fostering researches and achievements."


Alessandro Laviano
(Sapienza - University of Rome, Italy)

"Open access journals are very useful for all scientists as they can have quick information in the different fields of science."


Philippe Hernigou
(Paris University, France)

"There are many scientists who can not afford the rather expensive subscriptions to scientific journals. Open access journals offer a good alternative for free access to good quality scientific information."


Fidel Toldrá
(Instituto de Agroquimica y Tecnologia de Alimentos, Spain)

"Open access journals have become a fundamental tool for students, researchers, patients and the general public. Many people from institutions which do not have library or cannot afford to subscribe scientific journals benefit of them on a daily basis. The articles are among the best and cover most scientific areas."


M. Bendandi
(University Clinic of Navarre, Spain)

"These journals provide researchers with a platform for rapid, open access scientific communication. The articles are of high quality and broad scope."


Peter Chiba
(University of Vienna, Austria)

"Open access journals are probably one of the most important contributions to promote and diffuse science worldwide."


Jaime Sampaio
(University of Trás-os-Montes e Alto Douro, Portugal)

"Open access journals make up a new and rather revolutionary way to scientific publication. This option opens several quite interesting possibilities to disseminate openly and freely new knowledge and even to facilitate interpersonal communication among scientists."


Eduardo A. Castro
(INIFTA, Argentina)

"Open access journals are freely available online throughout the world, for you to read, download, copy, distribute, and use. The articles published in the open access journals are high quality and cover a wide range of fields."


Kenji Hashimoto
(Chiba University, Japan)

"Open Access journals offer an innovative and efficient way of publication for academics and professionals in a wide range of disciplines. The papers published are of high quality after rigorous peer review and they are Indexed in: major international databases. I read Open Access journals to keep abreast of the recent development in my field of study."


Daniel Shek
(Chinese University of Hong Kong, Hong Kong)

"It is a modern trend for publishers to establish open access journals. Researchers, faculty members, and students will be greatly benefited by the new journals of Bentham Science Publishers Ltd. in this category."


Jih Ru Hwu
(National Central University, Taiwan)


Browse Contents



Webmaster Contact: info@benthamopen.net
Copyright © 2019 Bentham Open