Anonymised buffy coat donations were provided by the Scottish National Blood Transfusion Service (SNBTS) from registered blood donors with informed consent. Heparin (1,000 IU into 50 ml; CP Pharmaceuticals, Wrexham, UK) was added to buffy coat samples, and peripheral blood mononuclear cells (PBMCs) were separated using Histopaque-1077 (Sigma, Irvine, UK). PBMCs were washed in RPMI 1640 (Invitrogen), and then cryopreserved in 10% dimethyl sulphoxide (Sigma) in foetal bovine serum (FBS; Invitrogen).

293T/Phoenix Amp retroviral packaging cells (obtained from Prof. R Debets; University of Rotterdam), Madin–Darby canine kidney epithelial cells (MDCK; ATCC), and HT1080 cells (ATCC) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10% FBS (Invitrogen), 100U/ml penicillin, 50 µg/ml streptomycin. The Lymphoblastoid cell line LCL114 was derived by in vitro EBV infection of PBMCs from healthy donors (Wilkie et al., 2004) and cultured in RPMI 1640 (Invitrogen) supplemented with 10% FBS (Invitrogen) and 2mM L-glutamine, 100U/ml penicillin, 50 µg /ml streptomycin. The A/WSN/33 (H1N1) influenza virus, obtained from Dr D. Jackson, University of St Andrews, UK, was propagated in MDCK cells prior to use in this study.

The 14C2 Hybridoma cell line was obtained from Prof Robert Lamb (University of Illinois) and cultured in RPMI 1640 supplemented with 1 mM pyruvate, 2mM L-glutamine, hybridoma enhancing supplement (Sigma) and 20% FBS (Invtrogen). Total RNA was extracted from 1×10⁶ hybridoma cells using the RNeasy kit from Qiagen and treated with DNAse (RNAse deficient - Promega) to remove any contaminating DNA. 1 µg of DNase treated RNA was converted to cDNA using oligo dT primers and MMLV reverse transcriptase (Affinity Script Multiple Temperature cDNA synthesis kit, Stratagene). Using a mouse IgG primer set (Calbiochem) the variable heavy and light chain cDNA sequences were amplified and cloned into the PGEM-T easy vector (Promega). Clones were analysed by sequencing to confirm the presence of murine IgG sequences. Variable heavy and variable light chain sequences were joined with a Serine/Glycine linker to form a ScFv using PCR. The V_H was amplified using the primers V_H forward; 5’- ACTGCCATGGCCCAGGTCCAGCTGCAGCAG-‘3 and V_H reverse; 5’ GCCGCTGCCACCTCCGCCTGAACCGCCTCCACCGCTCGAGACAGTGACCAGAGTCCC- ‘3. The V_L was amplified using V_L forward; 5’-TCAGGCGGAGGTGGCAGCGGCGGTGGCGGGTCGACGGACATTGTGATGACACAGTC-3 and V_L reverse; 5’-TTTCTCGTGCGGCCGCACGTTTCAGCTCCAACTTGG 3’. Both PCR products were purified from a 2% agarose gel, 50 µg of each mixed together, annealed at 65°C, and subject to 5 rounds of PCR before the addition of the V_H forward primer and the V_L reverse primer to amplify the full length product (Fig. 1A). The 14C2 ScFv PCR product was cloned into the retroviral vector PMP71.tCD34.2A.CD19.CD3zeta [18Cheadle EJ, Hawkins RE, Batha H, O'Neill AL, Dovedi SJ, Gilham DE. Natural Expression of the CD19 Antigen Impacts the Long-Term Engraftment but Not Antitumor Activity of CD19-Specific Engineered T Cells J Immunol 2010; 184: 1885-96.] (Fig. 1B) by replacing the CD19 encoding sequence by digestion with ClaI and NotI.

Fig. (1) (A) Amino acid sequence of 14C2 ScFv. The Heavy and light variable chains are joined using a flexible Serine/Glycine linker sequence (bold). (B) Retroviral vector construct used to express the 14C2 ScFv.

Fig. (2) Expression of Influenza M2 in cell lines HT1080 and LCL114. Cells were transduced with retroviral construct expressing a deletion variant of M2 (Δ29-31, Δ62), that is less cytotoxic (A and B), or an empty retroviral construct (C and D). M2 was stained with the 14C2 monoclonal antibody and an anti-mouse HRP.

Fig. (3) Activation of NFAT in Jurkat T-cells in response to (A) peptide stimulation and (B) stimulation with M2 expressing HT1080 cells. Jurkat cells were transfected with the 14C2 CAR construct and a NFAT luciferase reporter construct. After stimulation with peptides or M2 expressing cells for 24 hours, the amount of Gaussia Luciferase secreted into the media was quantified (Relative light units - RLU). Experiments were performed in triplicate. Error bars represent the standard deviation of the mean.

Fig. (4) ELISPOT assay measuring the number of γ-IFN expressing PBMCs after stimulation for 24 hours with (A) M2 specific peptides, and (B) with M2 expressing LCL114 cell line. Experiments were performed in triplicate. Error bars represent the standard deviation of the mean.

Fig. (5) Titres of Influenza virus A/WSN/33 in the lungs of infected Balb/c mice infused IV with 1×106 14C2 CAR transduced spelonocytes or mock transduced splenocytes. Transduced splenocytes were transferred to the mice 1 day before intranasal infection with 500pfu of A/WSN/33. Groups of four mice were sacrificed on days 2, 4, 6, and 8 pi, and the viral titre determined in the lung by plaque assay. For days 4 and 6pi there is a statistical difference between lung titres in mock treated versus 14C2 CAR treated mice (p<0.001). Virus titres were zero on day 8 pi for both 14C2 CAR and mock treated mice. These data are representative of two independent experiments.

Fig. (6) H&E staining of lung sections taken at day 0, 2, 4, 6 and 8 post infection. Significant inflammation and lymphocyte infiltration is observed on days 2, 4, and 6 pi.

Fig. (7) Detecting the presence of tCD34 sequences in mouse lung cell homogenates using a nested PCR assay. tCD34 sequences were present on days 2 and 4 post infection (days 3 and 5 post infusion of 14C2 CAR splenocytes). (tCD34, 240bp, GAPDH, 407bp).

All peptides were synthesised by Thistle Scientific (Scotland). Three M2 specific peptides were used:

M2 terminal peptide; SLLTEVETP,

M2e; SLLTEVETPIRNEWGCRCNDSSD, and

M2 tetramer; SLLTEVETPIRNEWGCRCNDSSDGGG]₄-(branched K).

An unrelated peptide LIALWNLHGQALFLG (LMP-1) was used as a negative control.

The packaging cells (293T/Phoenix-Amp) were seeded at 1.5×10⁶ cells per 75 cm² flask coated with 0.1% gelatin/PBS and grown overnight at 37°C in 10 ml DMEM (10% FBS, 100U/ml penicillin, 50 µg/ml streptomycin, 2mM L-Glutamine). The following day, the media was refreshed 3 hours prior to transfection of the cells. PBMCs (from frozen stock) were resuspended in RPMI (20% FBS, 100U/ml penicillin, 50 µg/ml streptomycin, 2mM L-Glutamine) at a cell density of 2×10⁶/ml, and stimulated with OKT3 (anti-CD3 MAb) to a final concentration of 10 ng/ml, for 2 days (37°C / 5% CO₂). The packaging cell line was transfected with the 14C2 retroviral CAR construct and helper constructs pHIT60 and pColtGalV (provided by Prof R Debets, University of Rotterdam) (10 µg of each) to a total amount of 40 µg DNA, using the Calcium Phosphate transfection kit (Promega). Cells were incubated for 2 days (37°C/5% CO₂). Retrovirus was harvested from the transfected packaging cells and used to infect activated PBMCs. The virus supernatant was filtered through a 0.45 µm filter and IL-2 added to a final concentration of 100 IU/ml. 2 mls of virus was added to each well of a Non-tissue culture 24-well plate previously coated with retronectin (12 µg/ml in dH₂O; Takara, Cambrex), and centrifuged for 1 hour at 1000×g. Following centrifugation the supernatant was removed and 1×10⁶ activated PBMCs were then added per well. The cells were then centrifuged for 1 hour at 1000×g and incubated 4-5 hours (37°C/5% CO₂). The media was aspirated carefully from the wells and followed by addition of 2 ml RPMI (20% FBS, 100U/ml penicillin, 50 µg/ml streptomycin, 2mM L-Glutamine, 100 IU/ml IL-2) and incubated overnight (37°C/5% CO₂). Transduction efficiency was assessed at day 4 post transduction, using a CD34 specific antibody (Becton Dickinson; clone 582) to measure the expression of tCD34 on the surface of transduced cells using flow cytometry.

The packaging cells (293T/Phoenix Amp) were prepared and transfected as above except that the pColtGalV plasmid was replaced with pHIT123 (MLV-E Env, provided by Prof. R. Debets, University of Rotterdam). Spleens were isolated from Balb/c mice and passed through a 70 μm cell strainer into a 50 ml tube using 20mls of PBS. The harvested splenocytes were centrifuged, resuspended in 5 ml of filtered erylysis buffer (155 mM NH₄Cl, 10 mM KHCO₃, 0.1 mM EDTA, pH 7.4) and incubated for 4 min at 4°C. The cells were then washed twice in 20 ml of RPMI 1640 medium, before resuspending in 30 ml RPMI 1640 medium (+10% FBS, 100U/ml penicillin, 50 µg/ml streptomycin, 2mM L-Glutamine, 1 mM NaPyruvate, 50 μM β-mercaptoethanol) and counted. Splenocytes were seeded at 5x10⁶/ml in a T25 flask before addition of 2.5 μg/ml Concanavalin A (Calbiochem), 1ng/ml IL-7 (Santa Cruz) and 100 U/ml human rIL-2, and incubated for 24 hours. The activated splenocytes were then transduced with retrovirus harvested from the packaging cells using retronectin coated plates as described above. The transduced splenocytes were cultured in fresh culture media with 100 U/ml IL-2, at a cell density of 0.15×10⁶/ml in 2 ml per well of a 24 well plate for 2 days before being assessed for transduction efficiency using flow cytometry and a CD34 antibody.

Cells to be analysed were washed twice in PBSA (1% BSA, 0.1% sodium azide, 0.2% EDTA) by centrifugation at 120×g for 5 minutes. The supernatant was decanted and cells resuspended in residual liquid. 10µL of the anti-CD34 (clone 582) antibody was added and the tubes incubated for 20 minutes at 4°C in the dark. Cells were washed twice in PBSA then resuspended in 1x CellFix (Becton Dickinson) and evaluated on a FACScan (Becton Dickinson) flow cytometer. At least 10,000 events were acquired for each sample. Data were subsequently analysed using the CellQuest software.

The following oligonucleotides were annealed and subject to PCR to generate a dsDNA encoding the Influenza M2 protein with a deletion of residues 29-31 and 62:

5’CGGGATCCATGAGTCTTCTAACCGAGGTCGAAACGCCTATCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGATCCTCTCGTCATTATCATTGAGATCTTGC-3’ and 5’-TGCCTCGAGTAGTTTTTTATCTTTTC AAACCGTATTTAAAGCGACGATAAATGCATTTGAAAAAAAGACGATCAAGAATCCACAATATCAAGTGCAAGATCTCAATGATAATGACG-3’. The DNA was cloned into the retroviral expression vector pFB-Neo (Stratagene) using the restriction enzymes BamHI and XhoI. Recombinant retrovirus was produced by transfecting the pFB-Neo M2 plasmid into the packaging cells (293T/Phoenix Amp) as described for transduction of human PBMCs. The resulting retrovirus was then used to transduce the cell lines HT1080 and LCL114 (EBV transformed Lymphoblastoid cells line). Expression of the M2 protein was confirmed by staining with the 14C2 Monoclonal antibody (Fig. 2).

5×10⁶ Jurkat E6.1 T cells were transiently nucleofected with 5 μg GLuc-NFAT(RE)6 and 5 μg of 14C2 CAR construct using an Amaxa nucleofector (AmaxaBiosystems, Cologne, Germany) as described [19Govers C, Sebestyén Z, Berrevoets C, Venselaar H, Debets R. T Cell Receptor Fused to CD3ζ: Transmembrane Domain of CD3ζ Prevents TCR Mis-Pairing, Whereas Complete CD3ζ directs functional TCR expression Open Gene Ther J 2011; 4: 11-22.]. Briefly, T cells were resuspended in 100 μl supplemented buffer V to which was added and pulsed with the Nucleofector set at program C-16. Next, T cells were immediately transferred to 2.5 ml warm Jurkat T-cell medium in T25 flasks for overnight recovery (37°C, 5% CO2). 0.2 ×10⁶ transfected Jurkat T-cells were transferred to each well of a 96 well plate and stimulated with peptides (1µg/ml) or 0.1×10⁶ M2 expressing cell lines for 24 hours. Subsequently, 25 µl of cell supernatant was assayed for luciferase activity according to manufacturer`s instructions (Gluc substrate; New England Biolabs) using a Turner systems Luminometer.

BALB/c mice were purchased from Harlan UK Ltd (Oxon, UK). All work was carried out under a UK Home Office licence according to the Animals (Scientific Procedures) Act 1986. Ten-week-old female mice were used in all experiments. Mice were anaesthetized using halothane (Rhone Merieux Ltd) and 1×10⁶ transduced murine splenocytes were transferred to each mouse via the tail vein. 24 hrs after the transfer of transduced splenocytes, the mice were anaesthetized and infected intranasally with 5×10² p.f.u. of A/WSN/33 influenza virus in 40 µl PBS volume. Mice were weighed daily and assessed for visual signs of clinical disease, including inactivity, ruffled fur and laboured breathing. At this virus dose, animals do not exhibit clinical signs or weight loss. At various times after infection, mice were euthanized by CO₂ asphyxiation, and the lungs removed, homogenized in PBS and clarified by centrifugation. Titres of infectious virus were determined by standard plaque assays on MDCK cells.

DNA was extracted from lung tissue using the DNeasy blood and tissue DNA kit, according to manufacturers instructions (Qiagen). 100µg of extracted DNA was amplified using a nested PCR protocol with tCD34 specific primers (1^st round amplification: 5’-CAAGCCCTATACCTCCTCTT-3’ and 5’-GTGTTTTCTGGCTGTAGCTC-3’, 2^nd round amplification: 5’-CTGCGCCGAGTTTAAGAAAG-3’ and 5’-TGCTCGGTAAAGTCCAGGAT-3’) or murine GAPDH primers (5’-GCCCATCACCATCTTCCAG-3’ and 5’-TGAGCCCTTCCACAATGCC-3’).

Data were analysed using Graphpad Prism software (San Diego, CA). For the mouse infection experiments data were analysed using a two-way Anova with Bonferoni post-tests.

The M2e-specific 14C2 mAb was generated using M2 protein purified from A/WSN/33-infected CV1 cell lysates [17Zebedee SL, Lamb RA. Influenza A Virus M2 Protein: Monoclonal Antibody Restriction of Virus Growth and Detection of M2 in Virions J Virol 1988; 62(8): 2762-72.]. The antibody-binding site was located to the M2 ectodomain (M2e). Using the Hybridoma cell line (Prof RA Lamb, Northwestern University, Illinois, USA), we amplified the MAb variable chain regions and joined them together with a Serine/Glycine spacer sequence using PCR. The sequence of the resulting Single chain antibody (ScFv) is shown in Fig. 1A.

The 14C2 ScFv sequence was cloned into a retroviral expression vector [18Cheadle EJ, Hawkins RE, Batha H, O'Neill AL, Dovedi SJ, Gilham DE. Natural Expression of the CD19 Antigen Impacts the Long-Term Engraftment but Not Antitumor Activity of CD19-Specific Engineered T Cells J Immunol 2010; 184: 1885-96.]. This construct (Fig. 1B) places the ScFv sequence in frame with the T-cell receptor zeta chain transmembrane and signalling domain. The construct also encodes a truncated/inactive form of CD34 (tCD34) which acts as a marker of transduction. Both the tCD34 and 14C2 CAR were separated by the 2A protease signal from Encephalomyocarditis virus (EMCV), which cleaves the two proteins.

Two in vitro assays were used to determine the specificity of the two M2 CAR constructs. Firstly, an NFAT reporter assay [19Govers C, Sebestyén Z, Berrevoets C, Venselaar H, Debets R. T Cell Receptor Fused to CD3ζ: Transmembrane Domain of CD3ζ Prevents TCR Mis-Pairing, Whereas Complete CD3ζ directs functional TCR expression Open Gene Ther J 2011; 4: 11-22.], which is based on the fact that when T-cells become activated (through recognition of specific antigens), the NFAT transcription factor is upregulated and activated. This can then be measured through its ability to activate a luciferase reporter gene under the control of NFAT control sequences. The M2 CAR construct was transfected into Jurkat T-cells along with a NFAT luciferase reporter plasmid. These Jurkat T-cells were then exposed to M2 specific peptides, or M2 expressing cells (HT1080), and the luciferase activity measured in the supernatant. As shown in Fig. 3A, the 14C2 ScFv CAR resulted in NFAT activation when cells were stimulated with M2e and M2 tetramer peptides, but not with an irrelevant peptide (LMP-1). Significant activation of NFAT in response to M2 expressed on the surface of the HT1080 cell line (Fig. 2) was also observed (Fig. 3B).

In a second assay, the ELISPOT technique was used to further confirm the specific activation of T-cells with our 14C2 CAR construct in response to stimulation with M2. The ELISPOT assay detects the secretion of γ-Interferon (γ-IFN) from activated T-cells. This assay is quantitative since the γ-IFN produced from each activated T-cell is visualised as a spot on a membrane in a multi-well plate. These spots can be counted and represent the number of activated T-cells in a given population. Human PBMCs were transduced with the retroviral construct encoding the 14C2 CAR. The transduction efficiency as determined by tCD34 expression was 72.5% (data not shown). The transduced PBMCs were then assayed using ELISPOT for γ-IFN production upon stimulation with either M2 peptides or an M2 expressing LCL cell line (LCL114). As shown in Fig. (4), significant numbers of transduced T-cells were specifically activated (as measured by γ-IFN release) in response to the specific M2 stimulus.

After successfully showing in vitro that the 14C2 CAR was able to recognise and specifically activate transduced T-cells in response to M2 stimulation, 14C2 CAR transduced T-cells were assessed for their ability to modulate virus replication in BALB/c mice infected with the mouse adapted strain of influenza virus A/WSN/33.

Splenocytes were prepared from BALB/c spleens, activated by stimulation with anti-CD3 antibody, Concanavalin-A and IL-7, and transduced with the retroviral construct encoding 14C2 ScFv CAR. Transduction efficiency was measured though the expression of tCD34 at 88.5% (data not shown). As a control, splenocytes were also transduced with an empty retroviral construct (mock cells). One week post-transduction, the splenocytes (10⁶ cells per mouse) were administered intravenously (IV) via the tail vein. One day following the IV transfer of the cells the mice were infected intranasally with 500pfu of Influenza A/WSN/33. Mice were weighed daily, but showed no significant changes in weight during the course of the experiment (data not shown). On days 2, 4, 6 and 8 pi, groups of 4 mice were sacrificed and lungs removed for titration of virus. The data shown in Fig. (5) indicate that in mice receiving the mock transduced splenocytes, A/WSN/33 lung titres increased up to a peak on day 4, before being cleared by day 8. Mice receiving 14C2 M2 CAR transduced splenocytes, however, had a significantly reduced virus lung titre on day 4 (p<0.001), but a higher viral lung titre on day 6 (p<0.001), before being cleared by day 8. H&E staining of lung section revealed significant lymphocyte infiltration and inflammation of the lungs on days 2, 4, and 6 post infection for both 14C2 CAR treated mice and mock treated mice (Fig. 6). The presence of tCD34 sequences could be detected in the lungs of 14C2 CAR treated mice by nested PCR on days 2 and 4 post infection (days 3 and 5 post infusion; Fig. 7), indicating the presence of 14C2 CAR transduced lymphocytes.